CAP1 cdna clone
CAP1 cDNA Clone
Gene Names
CAP1; CAP; CAP1-PEN
Synonyms
CAP1; CAP1 cDNA Clone; CAP1 cdna clone
Sequence
atggctgacatgcaaaatctggtagaaagattggagagggcagtgggccgcctggaggcagtatctcatacctctgacatgcaccgtgggtatgcagacagtccttcaaaagcaggagcagctccatatgtgcaggcatttgactcgctgcttgctggtcctgtggcagagtacttgaagatcagtaaagagattgggggagacgtgcagaaacatgcggagatggtccacacaggtttgaagttggagcgagctctgttggttacagcttctcagtgtcaacagccagcagaaaataagctttccgatttgttggcacccatctcagagcagatcaaagaagtgataacctttcgggagaagaaccgaggcagcaagttgtttaatcacctgtcagctgtcagcgaaagtatccaggccctgggctgggtggctatggctcccaagcctggcccttatgtgaaagaaatgaatgatgccgccatgttttatacaaaccgagtcctcaaagagtacaaagatgtggataagaagcatgtagactgggtcaaagcttatttaagtatatggacagagctgcaggcttacattaaggagttccataccaccggactggcctggagcaaaacggggcctgtggcaaaagaactgagcggactgccatctggaccctctgccggatcaggtcctcctccccctccaccaggcccccctcctcccccagtctctaccagttcaggctcagatgagtctgcttcccgctcagcactgttcgcgcagattaatcagggggagagcattacacatgccctgaaacatgtatctgatgacatgaagactcacaagaaccctgccctgaaggctcagagtggtccagtacgcagtggccccaaaccattctctgcacctaaaccccaaaccagcccatcccccaaacgagccacaaagaaggagccagctgtacttgaactggagggcaagaagtggagagtggaaaatcaggaaaatgtttccaacctggtgattgaggacacagagctgaaacaggtggcttacatatacaagtgtgtcaacacgacattgcaaatcaagggcaaaattaactccattacagtagataactgtaagaaacttggcctggtattcgatgacgtggtgggcattgtggagataatcaacagtaaggatgtcaaagttcaggtaatgggtaaagtgccaaccatatccatcaacaaaacagatggctgccatgcttacctgagcaagaattccctggattgtgaaatagtcagtgccaaatcttccgagatgaatgtcctcattcctacagaaggcggtgactttaatgaattcccagttcctgagcagttcaagaccctatggaacgggcagaagttggtcaccacagtgacagaaattgctggataa
Sequence Length
1428
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
51,830 Da
NCBI Official Full Name
Homo sapiens CAP, adenylate cyclase-associated protein 1 (yeast), mRNA
NCBI Official Synonym Full Names
adenylate cyclase associated protein 1
NCBI Official Symbol
CAP1
NCBI Official Synonym Symbols
CAP; CAP1-PEN
NCBI Protein Information
adenylyl cyclase-associated protein 1
UniProt Protein Name
Adenylyl cyclase-associated protein 1
Protein Family
UniProt Gene Name
CAP1
UniProt Synonym Gene Names
CAP; CAP 1
UniProt Entry Name
CAP1_HUMAN
NCBI Description
The protein encoded by this gene is related to the S. cerevisiae CAP protein, which is involved in the cyclic AMP pathway. The human protein is able to interact with other molecules of the same protein, as well as with CAP2 and actin. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2016]
Uniprot Description
CAP1: an actin binding protein. Directly regulates filament dynamics and has been implicated in a number of complex developmental and morphological processes, including mRNA localization and the establishment of cell polarity.
Protein type: Actin-binding; Cytoskeletal
Chromosomal Location of Human Ortholog: 1p34.2
Cellular Component: cortical actin cytoskeleton; focal adhesion
Molecular Function: actin binding; adenylate cyclase binding
Biological Process: actin polymerization and/or depolymerization; adenylate cyclase activation; cell morphogenesis; establishment and/or maintenance of cell polarity; signal transduction
Research Articles on CAP1
Similar Products
Product Notes
The CAP1 cap1 (Catalog #AAA1267431) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgaca tgcaaaatct ggtagaaaga ttggagaggg cagtgggccg cctggaggca gtatctcata cctctgacat gcaccgtggg tatgcagaca gtccttcaaa agcaggagca gctccatatg tgcaggcatt tgactcgctg cttgctggtc ctgtggcaga gtacttgaag atcagtaaag agattggggg agacgtgcag aaacatgcgg agatggtcca cacaggtttg aagttggagc gagctctgtt ggttacagct tctcagtgtc aacagccagc agaaaataag ctttccgatt tgttggcacc catctcagag cagatcaaag aagtgataac ctttcgggag aagaaccgag gcagcaagtt gtttaatcac ctgtcagctg tcagcgaaag tatccaggcc ctgggctggg tggctatggc tcccaagcct ggcccttatg tgaaagaaat gaatgatgcc gccatgtttt atacaaaccg agtcctcaaa gagtacaaag atgtggataa gaagcatgta gactgggtca aagcttattt aagtatatgg acagagctgc aggcttacat taaggagttc cataccaccg gactggcctg gagcaaaacg gggcctgtgg caaaagaact gagcggactg ccatctggac cctctgccgg atcaggtcct cctccccctc caccaggccc ccctcctccc ccagtctcta ccagttcagg ctcagatgag tctgcttccc gctcagcact gttcgcgcag attaatcagg gggagagcat tacacatgcc ctgaaacatg tatctgatga catgaagact cacaagaacc ctgccctgaa ggctcagagt ggtccagtac gcagtggccc caaaccattc tctgcaccta aaccccaaac cagcccatcc cccaaacgag ccacaaagaa ggagccagct gtacttgaac tggagggcaa gaagtggaga gtggaaaatc aggaaaatgt ttccaacctg gtgattgagg acacagagct gaaacaggtg gcttacatat acaagtgtgt caacacgaca ttgcaaatca agggcaaaat taactccatt acagtagata actgtaagaa acttggcctg gtattcgatg acgtggtggg cattgtggag ataatcaaca gtaaggatgt caaagttcag gtaatgggta aagtgccaac catatccatc aacaaaacag atggctgcca tgcttacctg agcaagaatt ccctggattg tgaaatagtc agtgccaaat cttccgagat gaatgtcctc attcctacag aaggcggtga ctttaatgaa ttcccagttc ctgagcagtt caagacccta tggaacgggc agaagttggt caccacagtg acagaaattg ctggataa. It is sometimes possible for the material contained within the vial of "CAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
