C3AR1 cdna clone
C3AR1 cDNA Clone
Gene Names
C3AR1; AZ3B; C3AR; HNFAG09
Synonyms
C3AR1; C3AR1 cDNA Clone; C3AR1 cdna clone
Sequence
atggcgtctttctctgctgagaccaattcaactgacctactctcacagccatggaatgagcccccagtaattctctccatggtcattctcagccttacttttttactgggattgccaggcaatgggctggtgctgtgggtggctggcctgaagatgcagcggacagtgaacacaatttggttcctccacctcaccttggcggacctcctctgctgcctctccttgcccttctcgctggctcacttggctctccagggacagtggccctacggcaggttcctatgcaagctcatcccctccatcattgtcctcaacatgtttgccagtgtcttcctgcttactgccattagcctggatcgctgtcttgtggtattcaagccaatctggtgtcagaatcatcgcaatgtagggatggcctgctctatctgtggatgtatctgggtggtggcttttgtgatgtgcattcctgtgttcgtgtaccgggaaatcttcactacagacaaccataatagatgtggctacaaatttggtctctccagctcattagattatccagacttttatggagatccactagaaaacaggtctcttgaaaacattgttcagccgcctggagaaatgaatgataggttagatccttcctctttccaaacaaatgatcatccttggacagtccccactgtcttccaacctcaaacatttcaaagaccttctgcagattcactccctaggggttctgctaggttaacaagtcaaaatctgtattctaatgtatttaaacctgctgatgtggtctcacctaaaatccccagtgggtttcctattgaagatcacgaaaccagcccactggataactctgatgcttttctctctactcatttaaagctgttccctagcgcttctagcaattccttctacgagtctgagctaccacaaggtttccaggattattacaatttaggccaattcacagatgacgatcaagtgccaacacccctcgtggcaataacgatcactaggctagtggtgggtttcctgctgccctctgttatcatgatagcctgttacagcttcattgtcttccgaatgcaaaggggccgcttcgccaagtctcagagcaaaacctttcgagtggccgtggtggtggtggctgtctttcttgtctgctggactccataccacatttttggagtcctgtcattgcttactgacccagaaactcccttggggaaaactctgatgtcctgggatcatgtatgcattgctctagcatctgccaatagttgctttaatcccttcctttatgccctcttggggaaagattttaggaagaaagcaaggcagtccattcagggaattctggaggcagccttcagtgaggagctcacacgttccacccactgtccctcaaacaatgtcatttcagaaagaaatagtacaactgtgtga
Sequence Length
1449
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,864 Da
NCBI Official Full Name
Homo sapiens complement component 3a receptor 1, mRNA
NCBI Official Synonym Full Names
complement C3a receptor 1
NCBI Official Symbol
C3AR1
NCBI Official Synonym Symbols
AZ3B; C3AR; HNFAG09
NCBI Protein Information
C3a anaphylatoxin chemotactic receptor
UniProt Protein Name
C3a anaphylatoxin chemotactic receptor
Protein Family
UniProt Gene Name
C3AR1
UniProt Synonym Gene Names
AZ3B; C3R1; HNFAG09; C3AR; C3a-R
UniProt Entry Name
C3AR_HUMAN
NCBI Description
C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]
Uniprot Description
C3aR: Receptor for the chemotactic and inflammatory peptide anaphylatoxin C3a. This receptor stimulates chemotaxis, granule enzyme release and superoxide anion production. Belongs to the G-protein coupled receptor 1 family.
Protein type: Receptor, GPCR; Membrane protein, integral; GPCR, family 1; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 12p13.31
Cellular Component: integral to plasma membrane; plasma membrane
Molecular Function: complement component C3a receptor activity; G-protein coupled receptor activity; phosphoinositide phospholipase C activity
Biological Process: blood circulation; elevation of cytosolic calcium ion concentration; inflammatory response; regulation of complement activation
Research Articles on C3AR1
Similar Products
Product Notes
The C3AR1 c3ar1 (Catalog #AAA1273398) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtctt tctctgctga gaccaattca actgacctac tctcacagcc atggaatgag cccccagtaa ttctctccat ggtcattctc agccttactt ttttactggg attgccaggc aatgggctgg tgctgtgggt ggctggcctg aagatgcagc ggacagtgaa cacaatttgg ttcctccacc tcaccttggc ggacctcctc tgctgcctct ccttgccctt ctcgctggct cacttggctc tccagggaca gtggccctac ggcaggttcc tatgcaagct catcccctcc atcattgtcc tcaacatgtt tgccagtgtc ttcctgctta ctgccattag cctggatcgc tgtcttgtgg tattcaagcc aatctggtgt cagaatcatc gcaatgtagg gatggcctgc tctatctgtg gatgtatctg ggtggtggct tttgtgatgt gcattcctgt gttcgtgtac cgggaaatct tcactacaga caaccataat agatgtggct acaaatttgg tctctccagc tcattagatt atccagactt ttatggagat ccactagaaa acaggtctct tgaaaacatt gttcagccgc ctggagaaat gaatgatagg ttagatcctt cctctttcca aacaaatgat catccttgga cagtccccac tgtcttccaa cctcaaacat ttcaaagacc ttctgcagat tcactcccta ggggttctgc taggttaaca agtcaaaatc tgtattctaa tgtatttaaa cctgctgatg tggtctcacc taaaatcccc agtgggtttc ctattgaaga tcacgaaacc agcccactgg ataactctga tgcttttctc tctactcatt taaagctgtt ccctagcgct tctagcaatt ccttctacga gtctgagcta ccacaaggtt tccaggatta ttacaattta ggccaattca cagatgacga tcaagtgcca acacccctcg tggcaataac gatcactagg ctagtggtgg gtttcctgct gccctctgtt atcatgatag cctgttacag cttcattgtc ttccgaatgc aaaggggccg cttcgccaag tctcagagca aaacctttcg agtggccgtg gtggtggtgg ctgtctttct tgtctgctgg actccatacc acatttttgg agtcctgtca ttgcttactg acccagaaac tcccttgggg aaaactctga tgtcctggga tcatgtatgc attgctctag catctgccaa tagttgcttt aatcccttcc tttatgccct cttggggaaa gattttagga agaaagcaag gcagtccatt cagggaattc tggaggcagc cttcagtgag gagctcacac gttccaccca ctgtccctca aacaatgtca tttcagaaag aaatagtaca actgtgtga. It is sometimes possible for the material contained within the vial of "C3AR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
