Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C1QTNF1 cdna clone

C1QTNF1 cDNA Clone

Gene Names
C1QTNF1; GIP; CTRP1; ZSIG37
Synonyms
C1QTNF1; C1QTNF1 cDNA Clone; C1QTNF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctcccgtggacagggactcttgctggcgtactgcctgctccttgcctttgcctctggcctggtcctgagtcgtgtgccccatgtccagggggaacagcaggagtgggaggggactgaggagctgccgtcgcctccggaccatgccgagagggctgaagaacaacatgaaaaatacaggcccagtcaggaccaggggctccctgcttcccggtgcttgcgctgctgtgaccccggtacctccatgtacccggcgaccgccgtgccccagatcaacatcactatcttgaaaggggagaagggtgaccgcggagatcgaggcctccaagggaaatatggcaaaacaggctcagcaggggccaggggccacactggacccaaagggcagaagggctccatgggggcccctggggagcggtgcaagagccactacgccgccttttcggtgggccggaagaagcccatgcacagcaaccactactaccagacggtgatcttcgacacggagttcgtgaacctctacgaccacttcaacatgttcaccggcaagttctactgctacgtgcccggcctctacttcttcagcctcaacgtgcacacctggaaccagaaggagacctacctgcacatcatgaagaacgaggaggaggtggtgatcttgttcgcgcaggtgggcgaccgcagcatcatgcaaagccagagcctgatgctggagctgcgagagcaggaccaggtgtgggtacgcctctacaagggcgaacgtgagaacgccatcttcagcgaggagctggacacctacatcaccttcagtggctacctggtcaagcacgccaccgagccctag
Sequence Length
846
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,760 Da
NCBI Official Full Name
Homo sapiens C1q and tumor necrosis factor related protein 1, mRNA
NCBI Official Synonym Full Names
C1q and tumor necrosis factor related protein 1
NCBI Official Symbol
C1QTNF1
NCBI Official Synonym Symbols
GIP; CTRP1; ZSIG37
NCBI Protein Information
complement C1q tumor necrosis factor-related protein 1
UniProt Protein Name
Complement C1q tumor necrosis factor-related protein 1
UniProt Gene Name
C1QTNF1
UniProt Synonym Gene Names
CTRP1; GIP
UniProt Entry Name
C1QT1_HUMAN

Uniprot Description

C1QTNF1: 2 isoforms of the human protein are produced by alternative splicing

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: extracellular space; integral to plasma membrane

Molecular Function: collagen binding; protein binding

Biological Process: elevation of cytosolic calcium ion concentration

Research Articles on C1QTNF1

Similar Products

Product Notes

The C1QTNF1 c1qtnf1 (Catalog #AAA1265680) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctccc gtggacaggg actcttgctg gcgtactgcc tgctccttgc ctttgcctct ggcctggtcc tgagtcgtgt gccccatgtc cagggggaac agcaggagtg ggaggggact gaggagctgc cgtcgcctcc ggaccatgcc gagagggctg aagaacaaca tgaaaaatac aggcccagtc aggaccaggg gctccctgct tcccggtgct tgcgctgctg tgaccccggt acctccatgt acccggcgac cgccgtgccc cagatcaaca tcactatctt gaaaggggag aagggtgacc gcggagatcg aggcctccaa gggaaatatg gcaaaacagg ctcagcaggg gccaggggcc acactggacc caaagggcag aagggctcca tgggggcccc tggggagcgg tgcaagagcc actacgccgc cttttcggtg ggccggaaga agcccatgca cagcaaccac tactaccaga cggtgatctt cgacacggag ttcgtgaacc tctacgacca cttcaacatg ttcaccggca agttctactg ctacgtgccc ggcctctact tcttcagcct caacgtgcac acctggaacc agaaggagac ctacctgcac atcatgaaga acgaggagga ggtggtgatc ttgttcgcgc aggtgggcga ccgcagcatc atgcaaagcc agagcctgat gctggagctg cgagagcagg accaggtgtg ggtacgcctc tacaagggcg aacgtgagaa cgccatcttc agcgaggagc tggacaccta catcaccttc agtggctacc tggtcaagca cgccaccgag ccctag. It is sometimes possible for the material contained within the vial of "C1QTNF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.