C16orf80 cdna clone
C16orf80 cDNA Clone
Gene Names
CFAP20; GTL3; EVORF; fSAP23; C16orf80
Synonyms
C16orf80; C16orf80 cDNA Clone; C16orf80 cdna clone
Sequence
atgttcaaaaacacgttccagagcggcttcctctccatcctctacagcatcggcagcaagcctctgcaaatctgggacaaaaaggtacggaatggccacatcaaaagaatcactgataatgacatccagtccctggtgctagagattgaagggacaaatgtaagcaccacatatatcacatgccctgcagaccccaagaagacgctgggaattaaacttcctttccttgtcatgattatcaaaaacctgaagaagtattttaccttcgaagtgcaggtactagatgacaagaatgtgcgtcgtcgctttcgggcaagtaactaccagagcaccacccgggtcaaacccttcatctgcaccatgcccatgcggctggatgacggctggaaccagattcagttcaacttgctagacttcacacggcgagcatacggcaccaattacatcgagaccctcagagtgcagatccatgcaaattgtcgcatccgacgggtttacttctcagacagactctactcagaagatgagctgccggcagagttcaaactgtatctcccagttcagaacaaggcaaagcaataa
Sequence Length
582
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,774 Da
NCBI Official Full Name
Homo sapiens chromosome 16 open reading frame 80, mRNA
NCBI Official Synonym Full Names
cilia and flagella associated protein 20
NCBI Official Symbol
CFAP20
NCBI Official Synonym Symbols
GTL3; EVORF; fSAP23; C16orf80
NCBI Protein Information
cilia- and flagella-associated protein 20
UniProt Protein Name
Cilia- and flagella-associated protein 20
UniProt Gene Name
CFAP20
UniProt Synonym Gene Names
BUG22; C16orf80
UniProt Entry Name
CFA20_HUMAN
Uniprot Description
GTL3: Belongs to the UPF0468 family.
Protein type: Spliceosome
Chromosomal Location of Human Ortholog: 16q21
Cellular Component: centriole; cilium; nucleoplasm
Biological Process: multicellular organismal development; protein polyglutamylation
Similar Products
Product Notes
The C16orf80 cfap20 (Catalog #AAA1271878) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcaaaa acacgttcca gagcggcttc ctctccatcc tctacagcat cggcagcaag cctctgcaaa tctgggacaa aaaggtacgg aatggccaca tcaaaagaat cactgataat gacatccagt ccctggtgct agagattgaa gggacaaatg taagcaccac atatatcaca tgccctgcag accccaagaa gacgctggga attaaacttc ctttccttgt catgattatc aaaaacctga agaagtattt taccttcgaa gtgcaggtac tagatgacaa gaatgtgcgt cgtcgctttc gggcaagtaa ctaccagagc accacccggg tcaaaccctt catctgcacc atgcccatgc ggctggatga cggctggaac cagattcagt tcaacttgct agacttcaca cggcgagcat acggcaccaa ttacatcgag accctcagag tgcagatcca tgcaaattgt cgcatccgac gggtttactt ctcagacaga ctctactcag aagatgagct gccggcagag ttcaaactgt atctcccagt tcagaacaag gcaaagcaat aa. It is sometimes possible for the material contained within the vial of "C16orf80, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
