Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATP6V0E1 cdna clone

ATP6V0E1 cDNA Clone

Gene Names
ATP6V0E1; M9.2; ATP6H; Vma21; Vma21p; ATP6V0E
Synonyms
ATP6V0E1; ATP6V0E1 cDNA Clone; ATP6V0E1 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCGTATCACGGCCTCACTGTGCCTCTCATTGTGATGAGCGTGTTCTGGGGCTTCGTCGGCTTCTTGGTGCCTTGGTTCATCCCTAAGGGTCCTAACCGGGGAGTTATCATTACCATGTTGGTGACCTGTTCAGTTTGCTGCTATCTCTTTTGGCTGATTGCAATTCTGGCCCAACTCAACCCTCTCTTTGGACCGCAATTGAAAAATGAAACCATCTGGTATCTGAAGTATCATTGGCCTTGA
Sequence Length
246
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,374 Da
NCBI Official Full Name
Homo sapiens ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1, mRNA
NCBI Official Synonym Full Names
ATPase H+ transporting V0 subunit e1
NCBI Official Symbol
ATP6V0E1
NCBI Official Synonym Symbols
M9.2; ATP6H; Vma21; Vma21p; ATP6V0E
NCBI Protein Information
V-type proton ATPase subunit e 1
UniProt Protein Name
V-type proton ATPase subunit e 1
Protein Family
UniProt Gene Name
ATP6V0E1
UniProt Synonym Gene Names
ATP6H; ATP6V0E; V-ATPase subunit e 1
UniProt Entry Name
VA0E1_HUMAN

NCBI Description

This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is possibly part of the V0 subunit. Since two nontranscribed pseudogenes have been found in dog, it is possible that the localization to chromosome 2 for this gene by radiation hybrid mapping is representing a pseudogene. Genomic mapping puts the chromosomal location on 5q35.3. [provided by RefSeq, Jul 2008]

Uniprot Description

ATP6V0E1: Vacuolar ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells. Belongs to the V-ATPase e1/e2 subunit family.

Protein type: Membrane protein, multi-pass; Hydrolase; Transporter, ion channel; Transporter; Membrane protein, integral; Transporter, iron

Chromosomal Location of Human Ortholog: 5q35.1

Cellular Component: endosome membrane; membrane; phagocytic vesicle membrane

Molecular Function: ATPase activity, coupled to transmembrane movement of ions; hydrogen ion transporting ATPase activity, rotational mechanism

Biological Process: cell growth; insulin receptor signaling pathway; proton transport; transferrin transport; vacuolar acidification

Research Articles on ATP6V0E1

Similar Products

Product Notes

The ATP6V0E1 atp6v0e1 (Catalog #AAA1276770) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCGTATC ACGGCCTCAC TGTGCCTCTC ATTGTGATGA GCGTGTTCTG GGGCTTCGTC GGCTTCTTGG TGCCTTGGTT CATCCCTAAG GGTCCTAACC GGGGAGTTAT CATTACCATG TTGGTGACCT GTTCAGTTTG CTGCTATCTC TTTTGGCTGA TTGCAATTCT GGCCCAACTC AACCCTCTCT TTGGACCGCA ATTGAAAAAT GAAACCATCT GGTATCTGAA GTATCATTGG CCTTGA. It is sometimes possible for the material contained within the vial of "ATP6V0E1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.