Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASAH1 cdna clone

ASAH1 cDNA Clone

Gene Names
ASAH1; AC; PHP; ASAH; PHP32; ACDase; SMAPME
Synonyms
ASAH1; ASAH1 cDNA Clone; ASAH1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgggccggagttgcgtcgccttagtcctcctggctgccgccgtcagctgtgccgtcgcgcagcacgcgccgccgtggacagaggactgcagaaaatcaacctatcctccttcaggaccaacgtacagaggtgcagttccatggtacaccataaatcttgacttaccaccctacaaaagatggcatgaattgatgcttgacaaggcaccaatgctaaaggttatagtgaattctctgaagaatatgataaatacattcgtgccaagtggaaaagttatgcaggtggtggatgaaaaattgcctggcctacttggcaactttcctggcccttttgaagaggaaatgaagggtattgccgctgttactgatatacctttaggagagattatttcattcaatattttttatgaattatttaccatttgtacttcaatagtagcagaagacaaaaaaggtcatctaatacatgggagaaacatggattttggagtatttcttgggtggaacataaataatgatacctgggtcataactgagcaactaaaacctttaacagtgaatttggatttccaaagaaacaacaaaactgtcttcaaggcttcaagctttgctggctatgtgggcatgttaacaggattcaaaccaggactgttcagtcttacactgaatgaacgtttcagtataaatggtggttatctgggtattctagaatggattctgggaaagaaagatgccatgtggatagggttcctcactagaacagttctggaaaatagcacaagttatgaagaagccaagaatttattgaccaagaccaagatattggccccagcctactttatcctgggaggcaaccagtctggggaaggttgtgtgattacacgagacagaaaggaatcattggatgtatatgaactcgatgctaagcagggtagatggtatgtggtacaaacaaattatgaccgttggaaacatcccttcttccttgatgatcgcagaacgcctgcaaagatgtgtctgaaccgcaccagccaagagaatatctcatttgaaaccatgtatgatgtcctgtcaacaaaacctgtcctcaacaagctgaccgtatacacaaccttgatagatgttaccaaaggtcaattcgaaacttacctgcgggactgccctgacccttgtataggttggtga
Sequence Length
1188
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
427
Molecular Weight
44,046 Da
NCBI Official Full Name
Homo sapiens N-acylsphingosine amidohydrolase (acid ceramidase) 1, mRNA
NCBI Official Synonym Full Names
N-acylsphingosine amidohydrolase 1
NCBI Official Symbol
ASAH1
NCBI Official Synonym Symbols
AC; PHP; ASAH; PHP32; ACDase; SMAPME
NCBI Protein Information
acid ceramidase
UniProt Protein Name
Acid ceramidase
Protein Family
UniProt Gene Name
ASAH1
UniProt Synonym Gene Names
ASAH; AC; ACDase; Acid CDase; PHP32
UniProt Entry Name
ASAH1_HUMAN

NCBI Description

This gene encodes a member of the acid ceramidase family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. Processing of this preproprotein generates alpha and beta subunits that heterodimerize to form the mature lysosomal enzyme, which catalyzes the degradation of ceramide into sphingosine and free fatty acid. This enzyme is overexpressed in multiple human cancers and may play a role in cancer progression. Mutations in this gene are associated with the lysosomal storage disorder, Farber lipogranulomatosis, and a neuromuscular disorder, spinal muscular atrophy with progressive myoclonic epilepsy. [provided by RefSeq, Oct 2015]

Uniprot Description

ASAH1: Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid. Defects in ASAH1 are the cause of Farber lipogranulomatosis (FL); also known as Farber disease (FD). This sphingolipid disease is characterized by subcutaneous lipid-loaded nodules, excruciating pain in the joints and extremities, marked accumulation of ceramide in lysosomes, and death by three years of age. Defects in ASAH1 are the cause of spinal muscular atrophy with progressive myoclonic epilepsy (SMAPME). An autosomal recessive neuromuscular disorder characterized by childhood onset of motor deficits and progressive myoclonic seizures, after normal developmental milestones. Proximal muscle weakness and generalized muscular atrophy are due to degeneration of spinal motor neurons. Myoclonic epilepsy is generally resistant to conventional therapy. The disease course is progressive and leads to respiratory muscle involvement and severe handicap or early death from respiratory insufficiency. Belongs to the acid ceramidase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.5.1.23; Lipid Metabolism - sphingolipid; Hydrolase

Chromosomal Location of Human Ortholog: 8p22

Cellular Component: extracellular space; lysosomal lumen

Molecular Function: catalytic activity; ceramidase activity

Biological Process: ceramide metabolic process; glycosphingolipid metabolic process

Disease: Farber Lipogranulomatosis

Research Articles on ASAH1

Similar Products

Product Notes

The ASAH1 asah1 (Catalog #AAA1271618) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgggcc ggagttgcgt cgccttagtc ctcctggctg ccgccgtcag ctgtgccgtc gcgcagcacg cgccgccgtg gacagaggac tgcagaaaat caacctatcc tccttcagga ccaacgtaca gaggtgcagt tccatggtac accataaatc ttgacttacc accctacaaa agatggcatg aattgatgct tgacaaggca ccaatgctaa aggttatagt gaattctctg aagaatatga taaatacatt cgtgccaagt ggaaaagtta tgcaggtggt ggatgaaaaa ttgcctggcc tacttggcaa ctttcctggc ccttttgaag aggaaatgaa gggtattgcc gctgttactg atataccttt aggagagatt atttcattca atatttttta tgaattattt accatttgta cttcaatagt agcagaagac aaaaaaggtc atctaataca tgggagaaac atggattttg gagtatttct tgggtggaac ataaataatg atacctgggt cataactgag caactaaaac ctttaacagt gaatttggat ttccaaagaa acaacaaaac tgtcttcaag gcttcaagct ttgctggcta tgtgggcatg ttaacaggat tcaaaccagg actgttcagt cttacactga atgaacgttt cagtataaat ggtggttatc tgggtattct agaatggatt ctgggaaaga aagatgccat gtggataggg ttcctcacta gaacagttct ggaaaatagc acaagttatg aagaagccaa gaatttattg accaagacca agatattggc cccagcctac tttatcctgg gaggcaacca gtctggggaa ggttgtgtga ttacacgaga cagaaaggaa tcattggatg tatatgaact cgatgctaag cagggtagat ggtatgtggt acaaacaaat tatgaccgtt ggaaacatcc cttcttcctt gatgatcgca gaacgcctgc aaagatgtgt ctgaaccgca ccagccaaga gaatatctca tttgaaacca tgtatgatgt cctgtcaaca aaacctgtcc tcaacaagct gaccgtatac acaaccttga tagatgttac caaaggtcaa ttcgaaactt acctgcggga ctgccctgac ccttgtatag gttggtga. It is sometimes possible for the material contained within the vial of "ASAH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.