Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALMS1P cdna clone

ALMS1P cDNA Clone

Gene Names
ALMS1P1; ALMS1L; ALMS1P
Synonyms
ALMS1P; ALMS1P cDNA Clone; ALMS1P cdna clone
Ordering
For Research Use Only!
Sequence
atgcccatgaaggagtttcctggtttgttcctttggaaaatgtggagtctagataaaaagaaggaaaacatgctcaagactcatgaccctggcatctcccggttggaaccagtaaccaagaccaagccgtggagggagccactgtgggagcggaactggcaggggcagcacctggacagtcggggctacctggcaggcccaggcagagaggatggcagaaacccactgaagctgtttgtgagagcaaccctgcaggaatcgcttcagtttcacagacctgacttcatctcccacatttgggagcggataaagcgtctgaagttaatagtccaggagagaaagctgcagagcatgttaaagagcgagcgggatgcgctattcgacattgacagggaacggcagggccaccagaatcgcatgcgcccactacccaagagagtcttcctggctgtccagaagaacaagcctatcagcaagaaggaaatgattcagaggtccaaacggacacacgcaggaggaacagtagcacaaaggcttcccggtgccttgtgggtgaaagaaaggcttccagggaaaggagagaaacacccagggatcccggtgacgtcgggaagcagcacccagaccatgtaa
Sequence Length
633
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,624 Da
NCBI Official Full Name
Homo sapiens Alstrom syndrome 1 pseudogene, mRNA
NCBI Official Synonym Full Names
ALMS1, centrosome and basal body associated protein pseudogene 1
NCBI Official Symbol
ALMS1P1
NCBI Official Synonym Symbols
ALMS1L; ALMS1P
UniProt Protein Name
Putative ALMS1-like protein
UniProt Gene Name
ALMS1P
UniProt Synonym Gene Names
ALMS1L
UniProt Entry Name
ALM1L_HUMAN

Similar Products

Product Notes

The ALMS1P alms1p (Catalog #AAA1266769) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccatga aggagtttcc tggtttgttc ctttggaaaa tgtggagtct agataaaaag aaggaaaaca tgctcaagac tcatgaccct ggcatctccc ggttggaacc agtaaccaag accaagccgt ggagggagcc actgtgggag cggaactggc aggggcagca cctggacagt cggggctacc tggcaggccc aggcagagag gatggcagaa acccactgaa gctgtttgtg agagcaaccc tgcaggaatc gcttcagttt cacagacctg acttcatctc ccacatttgg gagcggataa agcgtctgaa gttaatagtc caggagagaa agctgcagag catgttaaag agcgagcggg atgcgctatt cgacattgac agggaacggc agggccacca gaatcgcatg cgcccactac ccaagagagt cttcctggct gtccagaaga acaagcctat cagcaagaag gaaatgattc agaggtccaa acggacacac gcaggaggaa cagtagcaca aaggcttccc ggtgccttgt gggtgaaaga aaggcttcca gggaaaggag agaaacaccc agggatcccg gtgacgtcgg gaagcagcac ccagaccatg taa. It is sometimes possible for the material contained within the vial of "ALMS1P, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.