Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADCYAP1R1 cdna clone

ADCYAP1R1 cDNA Clone

Gene Names
ADCYAP1R1; PAC1; PAC1R; PACAPR; PACAPRI
Synonyms
ADCYAP1R1; ADCYAP1R1 cDNA Clone; ADCYAP1R1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctggtgtcgtgcacgtttccctggctgctctcctcctgctgcctatggcccctgccatgcattctgactgcatcttcaagaaggagcaagccatgtgcctggagaagatccagagggccaatgagctgatgggcttcaatgattcctctccaggctgtcctgggatgtgggacaacatcacgtgttggaagcccgcccatgtgggtgagatggtcctggtcagctgccctgagctcttccgaatcttcaacccagaccaagtctgggagaccgaaaccattggagagtctgattttggtgacagtaactccttagatctctcagacatgggagtggtgagccggaactgcacggaggatggctggtcggaacccttccctcattactttgatgcctgtgggtttgatgaatatgaatctgagactggggaccaggattattactacctgtcagtgaaggccctctacacggttggctacagcacatccctcgtcaccctcaccactgccatggtcatcctttgtcgcttccggaagctgcactgcacacgcaacttcatccacatgaacctgtttgtgtcgttcatgctgagggcgatctccgtcttcatcaaagactggattctgtatgcggagcaggacagcaaccactgcttcatctccactgtggaatgtaaggccgtcatggttttcttccactactgtgttgtgtccaactacttctggctgttcatcgagggcctgtacctcttcactctgctggtggagaccttcttccctgaaaggagatacttctactggtacaccatcattggctgggggaccccaactgtgtgtgtgacagtgtgggctacgctgagactctactttgatgacacaggctgctgggatatgaatgacagcacagctctgtggtgggtgatcaaaggccctgtggttggctctatcatggttaactttgtgctttttattggcattatcgtcatccttgtgcagaaacttcagtctccagacatgggaggcaatgagtccagcatctacttcagctgcgtgcagaaatgctactgcaagccacagcgggctcagcagcactcttgcaagatgtcagaactgtccaccattactctgcgactggcccggtccaccctgctgctcatcccactattcggaatccactacacagtatttgccttctccccagagaatgtcagcaaaagggaaagactcgtgtttgagctggggctgggctccttccagggctttgtggtggctgttctctactgttttctgaatggtgaggtacaagcggagatcaagcgaaaatggcgaagctggaaggtgaaccgttacttcgctgtggacttcaagcaccgacacccgtctctggccagcagtggggtgaatgggggcacccagctctccatcctgagcaagagcagctcccaaatccgcatgtctggcctccctgctgacaatctggccacctga
Sequence Length
1491
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
117
Molecular Weight
46,957 Da
NCBI Official Full Name
Homo sapiens adenylate cyclase activating polypeptide 1 (pituitary) receptor type I, mRNA
NCBI Official Synonym Full Names
ADCYAP receptor type I
NCBI Official Symbol
ADCYAP1R1
NCBI Official Synonym Symbols
PAC1; PAC1R; PACAPR; PACAPRI
NCBI Protein Information
pituitary adenylate cyclase-activating polypeptide type I receptor
UniProt Protein Name
Pituitary adenylate cyclase-activating polypeptide type I receptor
UniProt Gene Name
ADCYAP1R1
UniProt Synonym Gene Names
PACAP type I receptor; PACAP-R-1; PACAP-R1
UniProt Entry Name
PACR_HUMAN

NCBI Description

This gene encodes type I adenylate cyclase activating polypeptide receptor, which is a membrane-associated protein and shares significant homology with members of the glucagon/secretin receptor family. This receptor mediates diverse biological actions of adenylate cyclase activating polypeptide 1 and is positively coupled to adenylate cyclase. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2010]

Uniprot Description

ADCYAP1R1: This is a receptor for PACAP-27 and PACAP-38. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. May regulate the release of adrenocorticotropin, luteinizing hormone, growth hormone, prolactin, epinephrine, and catecholamine. May play a role in spermatogenesis and sperm motility. Causes smooth muscle relaxation and secretion in the gastrointestinal tract. Belongs to the G-protein coupled receptor 2 family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Receptor, GPCR; GPCR, family 2

Chromosomal Location of Human Ortholog: 7p14

Cellular Component: integral to plasma membrane; plasma membrane; receptor complex

Molecular Function: protein binding; receptor activity

Research Articles on ADCYAP1R1

Similar Products

Product Notes

The ADCYAP1R1 adcyap1r1 (Catalog #AAA1272866) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctggtg tcgtgcacgt ttccctggct gctctcctcc tgctgcctat ggcccctgcc atgcattctg actgcatctt caagaaggag caagccatgt gcctggagaa gatccagagg gccaatgagc tgatgggctt caatgattcc tctccaggct gtcctgggat gtgggacaac atcacgtgtt ggaagcccgc ccatgtgggt gagatggtcc tggtcagctg ccctgagctc ttccgaatct tcaacccaga ccaagtctgg gagaccgaaa ccattggaga gtctgatttt ggtgacagta actccttaga tctctcagac atgggagtgg tgagccggaa ctgcacggag gatggctggt cggaaccctt ccctcattac tttgatgcct gtgggtttga tgaatatgaa tctgagactg gggaccagga ttattactac ctgtcagtga aggccctcta cacggttggc tacagcacat ccctcgtcac cctcaccact gccatggtca tcctttgtcg cttccggaag ctgcactgca cacgcaactt catccacatg aacctgtttg tgtcgttcat gctgagggcg atctccgtct tcatcaaaga ctggattctg tatgcggagc aggacagcaa ccactgcttc atctccactg tggaatgtaa ggccgtcatg gttttcttcc actactgtgt tgtgtccaac tacttctggc tgttcatcga gggcctgtac ctcttcactc tgctggtgga gaccttcttc cctgaaagga gatacttcta ctggtacacc atcattggct gggggacccc aactgtgtgt gtgacagtgt gggctacgct gagactctac tttgatgaca caggctgctg ggatatgaat gacagcacag ctctgtggtg ggtgatcaaa ggccctgtgg ttggctctat catggttaac tttgtgcttt ttattggcat tatcgtcatc cttgtgcaga aacttcagtc tccagacatg ggaggcaatg agtccagcat ctacttcagc tgcgtgcaga aatgctactg caagccacag cgggctcagc agcactcttg caagatgtca gaactgtcca ccattactct gcgactggcc cggtccaccc tgctgctcat cccactattc ggaatccact acacagtatt tgccttctcc ccagagaatg tcagcaaaag ggaaagactc gtgtttgagc tggggctggg ctccttccag ggctttgtgg tggctgttct ctactgtttt ctgaatggtg aggtacaagc ggagatcaag cgaaaatggc gaagctggaa ggtgaaccgt tacttcgctg tggacttcaa gcaccgacac ccgtctctgg ccagcagtgg ggtgaatggg ggcacccagc tctccatcct gagcaagagc agctcccaaa tccgcatgtc tggcctccct gctgacaatc tggccacctg a. It is sometimes possible for the material contained within the vial of "ADCYAP1R1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.