Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADAP1 cdna clone

ADAP1 cDNA Clone

Gene Names
ADAP1; GCS1L; CENTA1; p42IP4
Synonyms
ADAP1; ADAP1 cDNA Clone; ADAP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaaggagcggcgcagggcggtcctggagctgctgcagcggccggggaacgcgcgctgcgcggactgcggcgccccggatcccgactgggcctcctacactctgggcgtcttcatctgcctgagctgctcgggaatccaccggaatatcccccaggtcagcaaggtgaagtccgtccgcctggacgcctgggaggaggcccaagtggagttcatggcctcccacgggaacgacgccgcgagagccaggtttgagtccaaagtaccctccttctactaccggcccacgccctccgactgccagctccttcgagagcagtggatccgggccaagtacgagcgacaggagttcatctacccggagaagcaggagccctactcggcagggtaccgtgagggttttctctggaagcgtggccgggacaacgggcagtttttgagccggaagtttgtgctgacagaacgagagggtgctctgaagtatttcaacagaaatgatgccaaggagcccaaggccgtgatgaagatcgagcacctgaacgccaccttccagccggccaagatcggccacccccacggcctgcaggtcacctacctgaaggacaacagcacccgtaacatcttcatctaccatgaggacgggaaggagattgtggactggttcaatgcactccgagctgctcgcttccactacctgcaggtggcattcccaggggccagcgacgcagatctggtgccaaagctctccaggaactacctgaaggaaggctacatggagaagacggggcccaagcaaacggaaggcttccggaagcgctggttcaccatggatgaccgcaggctcatgtacttcaaagaccccctggacgccttcgcccgaggggaagtcttcattggcagcaaggagagtggctacacggtgctgcatgggttcccgccgtccacccagggccaccactggccacatggcatcaccatcgtcacgcccgaccgcaagtttctgtttgcctgcgagacggagtccgaccagagggagtgggtggcggccttccagaaggcggtggacaggcccatgctgccccaggagtacgcagtggaggcgcacttcaagcataaaccttag
Sequence Length
1125
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,353 Da
NCBI Official Full Name
Homo sapiens ArfGAP with dual PH domains 1, mRNA
NCBI Official Synonym Full Names
ArfGAP with dual PH domains 1
NCBI Official Symbol
ADAP1
NCBI Official Synonym Symbols
GCS1L; CENTA1; p42IP4
NCBI Protein Information
arf-GAP with dual PH domain-containing protein 1
UniProt Protein Name
Arf-GAP with dual PH domain-containing protein 1
UniProt Gene Name
ADAP1
UniProt Synonym Gene Names
CENTA1; Cnt-a1
UniProt Entry Name
ADAP1_HUMAN

Uniprot Description

CENTA1: GTPase-activating protein for the ADP ribosylation factor family (Probable). Binds phosphatidylinositol 3,4,5- trisphosphate (PtdInsP3) and inositol 1,3,4,5-tetrakisphosphate (InsP4).

Protein type: GAPs, ARF; GAPs

Chromosomal Location of Human Ortholog: 7p22.3

Cellular Component: cytoplasm; nucleus; plasma membrane

Molecular Function: GTPase activator activity; inositol 1,3,4,5 tetrakisphosphate binding; protein binding

Biological Process: cell surface receptor linked signal transduction; regulation of GTPase activity

Research Articles on ADAP1

Similar Products

Product Notes

The ADAP1 adap1 (Catalog #AAA1277717) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaagg agcggcgcag ggcggtcctg gagctgctgc agcggccggg gaacgcgcgc tgcgcggact gcggcgcccc ggatcccgac tgggcctcct acactctggg cgtcttcatc tgcctgagct gctcgggaat ccaccggaat atcccccagg tcagcaaggt gaagtccgtc cgcctggacg cctgggagga ggcccaagtg gagttcatgg cctcccacgg gaacgacgcc gcgagagcca ggtttgagtc caaagtaccc tccttctact accggcccac gccctccgac tgccagctcc ttcgagagca gtggatccgg gccaagtacg agcgacagga gttcatctac ccggagaagc aggagcccta ctcggcaggg taccgtgagg gttttctctg gaagcgtggc cgggacaacg ggcagttttt gagccggaag tttgtgctga cagaacgaga gggtgctctg aagtatttca acagaaatga tgccaaggag cccaaggccg tgatgaagat cgagcacctg aacgccacct tccagccggc caagatcggc cacccccacg gcctgcaggt cacctacctg aaggacaaca gcacccgtaa catcttcatc taccatgagg acgggaagga gattgtggac tggttcaatg cactccgagc tgctcgcttc cactacctgc aggtggcatt cccaggggcc agcgacgcag atctggtgcc aaagctctcc aggaactacc tgaaggaagg ctacatggag aagacggggc ccaagcaaac ggaaggcttc cggaagcgct ggttcaccat ggatgaccgc aggctcatgt acttcaaaga ccccctggac gccttcgccc gaggggaagt cttcattggc agcaaggaga gtggctacac ggtgctgcat gggttcccgc cgtccaccca gggccaccac tggccacatg gcatcaccat cgtcacgccc gaccgcaagt ttctgtttgc ctgcgagacg gagtccgacc agagggagtg ggtggcggcc ttccagaagg cggtggacag gcccatgctg ccccaggagt acgcagtgga ggcgcacttc aagcataaac cttag. It is sometimes possible for the material contained within the vial of "ADAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.