Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACTL6A cdna clone

ACTL6A cDNA Clone

Gene Names
ACTL6A; Arp4; ACTL6; BAF53A; INO80K; ARPN-BETA
Synonyms
ACTL6A; ACTL6A cDNA Clone; ACTL6A cdna clone
Ordering
For Research Use Only!
Sequence
atgagcggcggcgtgtacgggggagatgaagttggagcccttgtttttgacattggatcctatactgtgagagctggttatgctggtgaggactgccccaaggtggattttcctacagctattggtatggtggtagaaagagatgacggaagcacattaatggaaatagatggcgataaaggcaaacaaggcggtcccacctactacatagatactaatgctctgcgtgttccgagggagaatatggaggccatttcacctctaaaaaatgggatggttgaagactgggatagtttccaagctattttggatcatacctacaaaatgcatgtcaaatcagaagccagtctccatcctgttctcatgtcagaggcaccgtggaatactagagcaaagagagagaaactgacagagttaatgtttgaacactacaacatccctgccttcttcctttgcaaaactgcagttttgacagcatttgctaatggtcgttctactgggctgattttggacagtggagccactcataccactgcaattccagtccacgatggctatgtccttcaacaaggcattgtgaaatcccctcttgctggagactttattactatgcagtgcagagaactcttccaagaaatgaatattgaattggttcctccatatatgattgcatcaaaagaagctgttcgtgaaggatctccagcaaactggaaaagaaaagagaagttgcctcaggttacgaggtcttggcacaattatatgtgtaattgtgttatccaggattttcaagcttcggtacttcaagtgtcagattcaacttatgatgaacaagtggctgcacagatgccaactgttcattatgaattccccaatggctacaattgtgattttggtgcagagcggctaaagattccagaaggattatttgacccttccaatgtaaaggggttatcaggaaacacaatgttaggagtcagtcatgttgtcaccacaagtgttgggatgtgtgatattgatatcagaccaggtctctatggcagtgtaatagtggcaggaggaaacacactaatacagagttttactgacaggttgaatagagagctgtctcagaaaactcctccaagtatgcggttgaaattgattgcaaataatacaacagtggaacggaggtttagctcatggattggcggctccattctagcctctttgggtacctttcaacagatgtggatttccaagcaagaatatgaagaaggagggaagcagtgtgtagaaagaaaatgcccttga
Sequence Length
1290
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
86
Molecular Weight
43,236 Da
NCBI Official Full Name
Homo sapiens actin-like 6A, mRNA
NCBI Official Synonym Full Names
actin like 6A
NCBI Official Symbol
ACTL6A
NCBI Official Synonym Symbols
Arp4; ACTL6; BAF53A; INO80K; ARPN-BETA
NCBI Protein Information
actin-like protein 6A
UniProt Protein Name
Actin-like protein 6A
Protein Family
UniProt Gene Name
ACTL6A
UniProt Synonym Gene Names
BAF53; BAF53A; INO80K; BAF53A
UniProt Entry Name
ACL6A_HUMAN

NCBI Description

This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

BAF53A: an actin-related protein involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Required for maximal ATPase activity of the helicase SMARCA4 and for association of the SMARCA4 containing remodelling complex BAF with chromatin/nuclear matrix. A component of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of specific genes. Two alternatively spliced human isoforms have been described.

Chromosomal Location of Human Ortholog: 3q26.33

Cellular Component: NuA4 histone acetyltransferase complex; nuclear chromatin; nucleoplasm; nucleus; plasma membrane; protein complex; SWI/SNF complex

Molecular Function: chromatin binding; nucleosomal DNA binding; protein binding

Biological Process: ATP-dependent chromatin remodeling; chromatin remodeling; signal transduction

Research Articles on ACTL6A

Similar Products

Product Notes

The ACTL6A actl6a (Catalog #AAA1270708) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcggcg gcgtgtacgg gggagatgaa gttggagccc ttgtttttga cattggatcc tatactgtga gagctggtta tgctggtgag gactgcccca aggtggattt tcctacagct attggtatgg tggtagaaag agatgacgga agcacattaa tggaaataga tggcgataaa ggcaaacaag gcggtcccac ctactacata gatactaatg ctctgcgtgt tccgagggag aatatggagg ccatttcacc tctaaaaaat gggatggttg aagactggga tagtttccaa gctattttgg atcataccta caaaatgcat gtcaaatcag aagccagtct ccatcctgtt ctcatgtcag aggcaccgtg gaatactaga gcaaagagag agaaactgac agagttaatg tttgaacact acaacatccc tgccttcttc ctttgcaaaa ctgcagtttt gacagcattt gctaatggtc gttctactgg gctgattttg gacagtggag ccactcatac cactgcaatt ccagtccacg atggctatgt ccttcaacaa ggcattgtga aatcccctct tgctggagac tttattacta tgcagtgcag agaactcttc caagaaatga atattgaatt ggttcctcca tatatgattg catcaaaaga agctgttcgt gaaggatctc cagcaaactg gaaaagaaaa gagaagttgc ctcaggttac gaggtcttgg cacaattata tgtgtaattg tgttatccag gattttcaag cttcggtact tcaagtgtca gattcaactt atgatgaaca agtggctgca cagatgccaa ctgttcatta tgaattcccc aatggctaca attgtgattt tggtgcagag cggctaaaga ttccagaagg attatttgac ccttccaatg taaaggggtt atcaggaaac acaatgttag gagtcagtca tgttgtcacc acaagtgttg ggatgtgtga tattgatatc agaccaggtc tctatggcag tgtaatagtg gcaggaggaa acacactaat acagagtttt actgacaggt tgaatagaga gctgtctcag aaaactcctc caagtatgcg gttgaaattg attgcaaata atacaacagt ggaacggagg tttagctcat ggattggcgg ctccattcta gcctctttgg gtacctttca acagatgtgg atttccaagc aagaatatga agaaggaggg aagcagtgtg tagaaagaaa atgcccttga. It is sometimes possible for the material contained within the vial of "ACTL6A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.