Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PLTP cdna clone

PLTP cDNA Clone

Gene Names
PLTP; BPIFE; HDLCQ9
Synonyms
PLTP; PLTP cDNA Clone; PLTP cdna clone
Ordering
For Research Use Only!
Sequence
atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagtgttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaaggccacttctactacaacatctctgaggtgaaggtcacagagctgcaactgacatcttccgagctcgatttccagccacagcaggagctgatgcttcaaatcaccaatgcctccttggggctgcgcttccggagacagctgctctactggttcttctatgatgggggctacatcaacgcctcagctgagggtgtgtccatccgcactggtctggagctctcccgggatcccgctggacggatgaaagtgtccaatgtctcctgccaggcctctgtctccagaatgcacgcggccttcgggggaaccttcaagaaggtgtatgattttctctccacgttcatcacctcagggatgcgcttcctcctcaaccagcagatctgccctgtcctctaccacgcagggacggtcctgctcaactccctcctggacaccgtgcctgtgcgcagttctgtggacgagcttgttggcattgactattccctcatgaaggatcctgtggcttccaccagcaacctggacatggacttccggggggccttcttccccctgactgagaggaactggagcctccccaaccgggcagtggagccccagctgcaggaggaagagcggatggtgtatgtggccttctctgagttcttcttcgactctgccatggagagctacttccgggcgggggccctgcagctgttgctggtgggggacaaggtgccccacgacctggacatgctgctgagggccacctactttgggagcattgtcctgctgagcccagcagtgattgactccccattgaagctggagctgcgggtcctggccccaccgcgctgcaccatcaagccctctggcaccaccatctctgtcactgctagcgtcaccattgccctggtcccaccagaccagcctgaggtccagctgtccagcatgactatggacgcccgtctcagcgccaagatggctctccgggggaaggccctgcgcacgcagctggacctgcgcaggttccgaatctattccaaccattctgcactggagtcgctggctctgatcccattacaggcccctctgaagaccatgctgcagattggggtgatgcccatgctcaatgagcggacctggcgtggggtgcagatcccactacctgagggcatcaactttgtgcatgaggtggtgacgaaccatgcgggattcctcaccatcggggctgatctccactttgccaaagggctgcgagaggtgattgagaagaaccggcctgctgatgtcagggcgtccactgcccccacaccgtccacagcagctgtctga
Sequence Length
1482
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,847 Da
NCBI Official Full Name
Homo sapiens phospholipid transfer protein, mRNA
NCBI Official Synonym Full Names
phospholipid transfer protein
NCBI Official Symbol
PLTP
NCBI Official Synonym Symbols
BPIFE; HDLCQ9
NCBI Protein Information
phospholipid transfer protein
UniProt Protein Name
Phospholipid transfer protein
UniProt Gene Name
PLTP
UniProt Entry Name
PLTP_HUMAN

NCBI Description

The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

PLTP: Converts HDL into larger and smaller particles. May play a key role in extracellular phospholipid transport and modulation of hdl particles. Belongs to the BPI/LBP/Plunc superfamily. BPI/LBP family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Lipid-binding; Secreted

Chromosomal Location of Human Ortholog: 20q13.12

Cellular Component: extracellular region; extracellular space

Research Articles on PLTP

Similar Products

Product Notes

The PLTP pltp (Catalog #AAA1279003) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctct tcggggccct cttcctagcg ctgctggcag gcgcacatgc agtgttccca ggctgcaaga tccgcgtcac ctccaaggcg ctggagctgg tgaagcagga ggggctgcgc tttctggagc aagagctgga gactatcacc attccggacc tgcggggcaa agaaggccac ttctactaca acatctctga ggtgaaggtc acagagctgc aactgacatc ttccgagctc gatttccagc cacagcagga gctgatgctt caaatcacca atgcctcctt ggggctgcgc ttccggagac agctgctcta ctggttcttc tatgatgggg gctacatcaa cgcctcagct gagggtgtgt ccatccgcac tggtctggag ctctcccggg atcccgctgg acggatgaaa gtgtccaatg tctcctgcca ggcctctgtc tccagaatgc acgcggcctt cgggggaacc ttcaagaagg tgtatgattt tctctccacg ttcatcacct cagggatgcg cttcctcctc aaccagcaga tctgccctgt cctctaccac gcagggacgg tcctgctcaa ctccctcctg gacaccgtgc ctgtgcgcag ttctgtggac gagcttgttg gcattgacta ttccctcatg aaggatcctg tggcttccac cagcaacctg gacatggact tccggggggc cttcttcccc ctgactgaga ggaactggag cctccccaac cgggcagtgg agccccagct gcaggaggaa gagcggatgg tgtatgtggc cttctctgag ttcttcttcg actctgccat ggagagctac ttccgggcgg gggccctgca gctgttgctg gtgggggaca aggtgcccca cgacctggac atgctgctga gggccaccta ctttgggagc attgtcctgc tgagcccagc agtgattgac tccccattga agctggagct gcgggtcctg gccccaccgc gctgcaccat caagccctct ggcaccacca tctctgtcac tgctagcgtc accattgccc tggtcccacc agaccagcct gaggtccagc tgtccagcat gactatggac gcccgtctca gcgccaagat ggctctccgg gggaaggccc tgcgcacgca gctggacctg cgcaggttcc gaatctattc caaccattct gcactggagt cgctggctct gatcccatta caggcccctc tgaagaccat gctgcagatt ggggtgatgc ccatgctcaa tgagcggacc tggcgtgggg tgcagatccc actacctgag ggcatcaact ttgtgcatga ggtggtgacg aaccatgcgg gattcctcac catcggggct gatctccact ttgccaaagg gctgcgagag gtgattgaga agaaccggcc tgctgatgtc agggcgtcca ctgcccccac accgtccaca gcagctgtct ga. It is sometimes possible for the material contained within the vial of "PLTP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.