Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBM17 cdna clone

RBM17 cDNA Clone

Gene Names
RBM17; SPF45
Synonyms
RBM17; RBM17 cDNA Clone; RBM17 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccctgtacgatgacctaggagtggagaccagtgactcaaaaacagaaggctggtccaaaaacttcaaacttctgcagtctcagcttcaggtgaagaaggcagctctcactcaggcaaagagccaaaggacgaaacaaagtacagtcctcgccccagtcattgacctgaagcgaggtggctcctcagatgaccggcaaattgtggacactccaccgcatgtagcagctgggctgaaggatcctgttcccagtgggttttctgcaggggaagttctgattcccttagctgacgaatatgaccctatgtttcctaatgattatgagaaagtagtgaagcgccaaagagaggaacgacagagacagcgggagctggaaagacaaaaggaaatagaagaaagggaaaaaaggcgtaaagacagacatgaagcaagtgggtttgcaaggagaccagatccagattctgatgaagatgaagattatgagcgagagaggaggaaaagaagtatgggcggagctgccattgccccacccacttctctggtagagaaagacaaagagttaccccgagattttccttatgaagaggactcaagacctcgatcacagtcttccaaagcagccattcctcccccagtgtacgaggaacaagacagaccgagatctccaaccggacctagcaactccttcctcgctaacatggggggcacggtggcgcacaagatcatgcagaagtacggcttccgggagggccagggtctggggaagcatgagcagggcctgagcactgccttgtcagtggagaagaccagcaagcgtggcggcaagatcatcgtgggcgacgccacagagaaagatgcatccaagaagtcagattcaaatccgctgactgaaatacttaagtgtcctactaaagtggtcttactaaggaacatggttggtgcgggagaggtggatgaagacttggaagttgaaaccaaggaagaatgtgaaaaatatggcaaagttggaaaatgtgtgatatttgaaattcctggtgcccctgatgatgaagcagtacggatatttttagaatttgagagagttgaatcagcaattaaagcggttgttgacttgaatgggaggtattttggtggacgggtggtaaaagcatgtttctacaatttggacaaattcagggtcttggatttggcagaacaagtttga
Sequence Length
1206
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,962 Da
NCBI Official Full Name
Homo sapiens RNA binding motif protein 17, mRNA
NCBI Official Synonym Full Names
RNA binding motif protein 17
NCBI Official Symbol
RBM17
NCBI Official Synonym Symbols
SPF45
NCBI Protein Information
splicing factor 45
UniProt Protein Name
Splicing factor 45
Protein Family
UniProt Gene Name
RBM17
UniProt Synonym Gene Names
SPF45
UniProt Entry Name
SPF45_HUMAN

NCBI Description

This gene encodes an RNA binding protein. The encoded protein is part of the spliceosome complex and functions in the second catalytic step of mRNA splicing. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 9 and 15. [provided by RefSeq, Mar 2009]

Uniprot Description

RBM17: Splice factor that binds to the single stranded 3'AG at the exon/intron border and promotes its utilization in the second catalytic step. Involved in the regulation of alternative splicing and the utilization of cryptic splice sites. Promotes the utilization of a cryptic splice site created by the beta-110 mutation in the HBB gene. The resulting frameshift leads to sickle cell anemia.

Protein type: RNA splicing; Spliceosome; RNA-binding

Chromosomal Location of Human Ortholog: 10p15.1

Molecular Function: protein binding

Biological Process: alternative nuclear mRNA splicing, via spliceosome

Research Articles on RBM17

Similar Products

Product Notes

The RBM17 rbm17 (Catalog #AAA1278967) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccctgt acgatgacct aggagtggag accagtgact caaaaacaga aggctggtcc aaaaacttca aacttctgca gtctcagctt caggtgaaga aggcagctct cactcaggca aagagccaaa ggacgaaaca aagtacagtc ctcgccccag tcattgacct gaagcgaggt ggctcctcag atgaccggca aattgtggac actccaccgc atgtagcagc tgggctgaag gatcctgttc ccagtgggtt ttctgcaggg gaagttctga ttcccttagc tgacgaatat gaccctatgt ttcctaatga ttatgagaaa gtagtgaagc gccaaagaga ggaacgacag agacagcggg agctggaaag acaaaaggaa atagaagaaa gggaaaaaag gcgtaaagac agacatgaag caagtgggtt tgcaaggaga ccagatccag attctgatga agatgaagat tatgagcgag agaggaggaa aagaagtatg ggcggagctg ccattgcccc acccacttct ctggtagaga aagacaaaga gttaccccga gattttcctt atgaagagga ctcaagacct cgatcacagt cttccaaagc agccattcct cccccagtgt acgaggaaca agacagaccg agatctccaa ccggacctag caactccttc ctcgctaaca tggggggcac ggtggcgcac aagatcatgc agaagtacgg cttccgggag ggccagggtc tggggaagca tgagcagggc ctgagcactg ccttgtcagt ggagaagacc agcaagcgtg gcggcaagat catcgtgggc gacgccacag agaaagatgc atccaagaag tcagattcaa atccgctgac tgaaatactt aagtgtccta ctaaagtggt cttactaagg aacatggttg gtgcgggaga ggtggatgaa gacttggaag ttgaaaccaa ggaagaatgt gaaaaatatg gcaaagttgg aaaatgtgtg atatttgaaa ttcctggtgc ccctgatgat gaagcagtac ggatattttt agaatttgag agagttgaat cagcaattaa agcggttgtt gacttgaatg ggaggtattt tggtggacgg gtggtaaaag catgtttcta caatttggac aaattcaggg tcttggattt ggcagaacaa gtttga. It is sometimes possible for the material contained within the vial of "RBM17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.