Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF687 cdna clone

ZNF687 cDNA Clone

Gene Names
ZNF687; PDB6
Synonyms
ZNF687; ZNF687 cDNA Clone; ZNF687 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggatatgaagacccctgattttgatgacctccttgctgcctttgacatccctgacattgatgcgaatgaagccatccattctgggccagaagaaaatgaggggcctggaggcccagggaagccagaaccaggtgtaggaagtgaatctgaagacacagcagcagcctctgctggggatggccctggagttccagcccaggcctctgaccatggcctgccaccgccagacatttctgtagtcagtgtcattgtcaagaacactgtgtgtcccgagcagtctgaggccctggctggaggctcagcaggagacggggcccaggctgctggggtaactaaagaagggcctgtggggcctcatcgaatgcagaatggttttgggagccctgaaccttccctcccaggaactccccactctcctgctcctcccagtgggggcacctggaaagaaaaaggcatggaaggcaaaactcccttggacctgtttgctcattttggccctgagccaggggaccactcagatccgctgcctccctctgcaccctctcccactcgggagggggctctgaccccgcctcctttcccctcttcctttgagctggcccaggagaatggcccaggcatgcagccacctgtttcttccccaccattgggggccttgaagcaggagagctgcagcccccatcatccccaggtcctagcccaacaaggctcaggctccagccctaaggccacggacatccctgccagtgcctcgcctcccccagttgctggggtgcccttcttcaagcagtctccagggcaccagagccctcttgcctcccccaaagtgcccgtctgtcagcccttgaaggaagaagatgatgatgaggggccagtggacaagtcttccccaggaagtccccagagtccctctagtggggccgaggctgcagatgaggacagcaatgactcccctgcctccagctcctctaggcctcttaaggtgcggatcaagaccattaaaacatcctgcgggaatatcacaaggactgtaactcaggtcccctcagatcctgatccacctgcccccttggctgagggggccttcttggctgaggctagcctcttgaagctgtcccctgcaacacctacttctgagggtccaaaggtggtgagcgtacagttgggtgatggtacaaggctgaaaggcactgtgctgcctgtggccaccatccagaacgccagtactgccatgctgatggcagccagtgtggctcgcaaggctgtggtgctgcctggggggactgccaccagccctaagatgattgctaagaacgtgctaggcctggtgccccaagccctgcctaaggctgacgggcgggcagggctggggactgggggacagaaggtgaatggtgcctcggtggtgatggtgcaaccttcaaagacagctactgggccaagtacagggggcggcacagtgatatcacggacccagtccagcctggtggaggccttcaacaagatcctcaacagcaagaacctgctccctgcctataggccaaacctgagcccaccagctgaggctgggctggccctgcctcccaccggctaccgctgcctggagtgtggggatgccttctcattggagaagagcctggcacggcactatgaccgtcggagcatgcgcatcgaggtcacctgcaaccactgcgcccgccgcctggtcttcttcaacaagtgcagcctgctcctgcatgcacgtgaacacaaggacaaggggctcgtcatgcagtgctcacatttggtcatgaggcctgtagcccttgaccagatggtggggcagccggacatcacaccgctgctgcctgtagctgtcccacctgtctctggacctctggccttgcctgccttgggcaagggtgagggggccatcacctcctctgccattactacagttgctgctgaggcccctgtcctgccgctctccacagagccgcctgctgccccggccacctctgcttacacatgctttcgctgcctggagtgcaaggaacagtgccgggacaaggctggcatggcagctcacttccagcagctcggcccccctgcccctggggccaccagcaatgtgtgcccaacctgccccatgatgctccccaatcgctgcagcttcagcgcccaccagcgcatgcataagaatcgacccccccatgtctgtcctgagtgtgggggcaacttcctgcaagccaattttcagacccatctccgggaggcctgtctgcacgtctctcgccgtgtaggatacaggtgccccagctgttcagtggtgtttgggggtgtgaactccatcaagtcccacatccagacgtcgcactgcgaggttttccacaagtgccccatctgccccatggccttcaagtctgggccaagtgcccatgcccacctctactcccagcatcccagcttccaaactcagcaggccaagctgatctacaagtgcgccatgtgcgacacagtcttcactcacaaacccctcctctcctcacacttcgaccagcacttgctgccccagcgtgtcagtgtctttaagtgcccgtcttgtcctctgctctttgcccaaaaaaggaccatgctggaacatctcaagaacacccatcagtctgggcgcttggaggagactgctgggaaaggggccgggggtgccctgctgacccccaagactgagcctgaggagctggctgtttctcagggaggggcagcccctgctactgaggagtcgtcttcatcttcagaagaggaggaagtacccagctcccctgagcccccccgtccagccaaacggcctcggcgggaactagggagcaaaggcctcaagggtgggggtggggggcctggaggctggacctgtggcctgtgtcactcctggttccctgagcgtgatgaatacgtggcccacatgaagaaggagcatggcaagtcagtgaaaaagttcccctgtcgcctgtgtgagcgctccttctgctccgcccccagcctgaggcgccatgtcagagttaatcacgagggcatcaagcgagtttacccctgcaggtattgcacagagggaaaacgcaccttcagcagccgcctgatcctagagaaacatgtccaggtccggcacggcttgcagcttggggcccagtcccctggccgggggaccaccttggctcggggttccagtgccagagcccaggggccaggtcggaaacgccgccagtcttctgactcttgcagtgaggagcctgacagcacgacaccgccagccaagtcccccaggggcggacctggatctggaggccatggccctctgcgctaccggagcagcagctccacagaacagagcctcatgatggggttgagggtggaggatggtgcccagcagtgcctcgactgtggcttgtgctttgcctcccctggctccctgagccgacaccgtttcatcagccacaagaagagacggggtgtgggtaaagccagtgccctggggctgggggatggggaggaagaggcccctccatcaaggtctgaccccgatggtggagactcacccctgcctgcttctggaggcccactgacctgtaaggtctgtggcaagagctgcgacagccctctaaacctcaagacccacttccgcacgcatggcatggcgttcatcagggctcggcagggggctgttggggacaactag
Sequence Length
3714
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
115,571 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 687, mRNA
NCBI Official Synonym Full Names
zinc finger protein 687
NCBI Official Symbol
ZNF687
NCBI Official Synonym Symbols
PDB6
NCBI Protein Information
zinc finger protein 687
UniProt Protein Name
Zinc finger protein 687
Protein Family
UniProt Gene Name
ZNF687
UniProt Synonym Gene Names
KIAA1441
UniProt Entry Name
ZN687_HUMAN

Uniprot Description

ZNF687: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 1q21.3

Disease: Paget Disease Of Bone 6

Research Articles on ZNF687

Similar Products

Product Notes

The ZNF687 znf687 (Catalog #AAA1278266) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggata tgaagacccc tgattttgat gacctccttg ctgcctttga catccctgac attgatgcga atgaagccat ccattctggg ccagaagaaa atgaggggcc tggaggccca gggaagccag aaccaggtgt aggaagtgaa tctgaagaca cagcagcagc ctctgctggg gatggccctg gagttccagc ccaggcctct gaccatggcc tgccaccgcc agacatttct gtagtcagtg tcattgtcaa gaacactgtg tgtcccgagc agtctgaggc cctggctgga ggctcagcag gagacggggc ccaggctgct ggggtaacta aagaagggcc tgtggggcct catcgaatgc agaatggttt tgggagccct gaaccttccc tcccaggaac tccccactct cctgctcctc ccagtggggg cacctggaaa gaaaaaggca tggaaggcaa aactcccttg gacctgtttg ctcattttgg ccctgagcca ggggaccact cagatccgct gcctccctct gcaccctctc ccactcggga gggggctctg accccgcctc ctttcccctc ttcctttgag ctggcccagg agaatggccc aggcatgcag ccacctgttt cttccccacc attgggggcc ttgaagcagg agagctgcag cccccatcat ccccaggtcc tagcccaaca aggctcaggc tccagcccta aggccacgga catccctgcc agtgcctcgc ctcccccagt tgctggggtg cccttcttca agcagtctcc agggcaccag agccctcttg cctcccccaa agtgcccgtc tgtcagccct tgaaggaaga agatgatgat gaggggccag tggacaagtc ttccccagga agtccccaga gtccctctag tggggccgag gctgcagatg aggacagcaa tgactcccct gcctccagct cctctaggcc tcttaaggtg cggatcaaga ccattaaaac atcctgcggg aatatcacaa ggactgtaac tcaggtcccc tcagatcctg atccacctgc ccccttggct gagggggcct tcttggctga ggctagcctc ttgaagctgt cccctgcaac acctacttct gagggtccaa aggtggtgag cgtacagttg ggtgatggta caaggctgaa aggcactgtg ctgcctgtgg ccaccatcca gaacgccagt actgccatgc tgatggcagc cagtgtggct cgcaaggctg tggtgctgcc tggggggact gccaccagcc ctaagatgat tgctaagaac gtgctaggcc tggtgcccca agccctgcct aaggctgacg ggcgggcagg gctggggact gggggacaga aggtgaatgg tgcctcggtg gtgatggtgc aaccttcaaa gacagctact gggccaagta cagggggcgg cacagtgata tcacggaccc agtccagcct ggtggaggcc ttcaacaaga tcctcaacag caagaacctg ctccctgcct ataggccaaa cctgagccca ccagctgagg ctgggctggc cctgcctccc accggctacc gctgcctgga gtgtggggat gccttctcat tggagaagag cctggcacgg cactatgacc gtcggagcat gcgcatcgag gtcacctgca accactgcgc ccgccgcctg gtcttcttca acaagtgcag cctgctcctg catgcacgtg aacacaagga caaggggctc gtcatgcagt gctcacattt ggtcatgagg cctgtagccc ttgaccagat ggtggggcag ccggacatca caccgctgct gcctgtagct gtcccacctg tctctggacc tctggccttg cctgccttgg gcaagggtga gggggccatc acctcctctg ccattactac agttgctgct gaggcccctg tcctgccgct ctccacagag ccgcctgctg ccccggccac ctctgcttac acatgctttc gctgcctgga gtgcaaggaa cagtgccggg acaaggctgg catggcagct cacttccagc agctcggccc ccctgcccct ggggccacca gcaatgtgtg cccaacctgc cccatgatgc tccccaatcg ctgcagcttc agcgcccacc agcgcatgca taagaatcga cccccccatg tctgtcctga gtgtgggggc aacttcctgc aagccaattt tcagacccat ctccgggagg cctgtctgca cgtctctcgc cgtgtaggat acaggtgccc cagctgttca gtggtgtttg ggggtgtgaa ctccatcaag tcccacatcc agacgtcgca ctgcgaggtt ttccacaagt gccccatctg ccccatggcc ttcaagtctg ggccaagtgc ccatgcccac ctctactccc agcatcccag cttccaaact cagcaggcca agctgatcta caagtgcgcc atgtgcgaca cagtcttcac tcacaaaccc ctcctctcct cacacttcga ccagcacttg ctgccccagc gtgtcagtgt ctttaagtgc ccgtcttgtc ctctgctctt tgcccaaaaa aggaccatgc tggaacatct caagaacacc catcagtctg ggcgcttgga ggagactgct gggaaagggg ccgggggtgc cctgctgacc cccaagactg agcctgagga gctggctgtt tctcagggag gggcagcccc tgctactgag gagtcgtctt catcttcaga agaggaggaa gtacccagct cccctgagcc cccccgtcca gccaaacggc ctcggcggga actagggagc aaaggcctca agggtggggg tggggggcct ggaggctgga cctgtggcct gtgtcactcc tggttccctg agcgtgatga atacgtggcc cacatgaaga aggagcatgg caagtcagtg aaaaagttcc cctgtcgcct gtgtgagcgc tccttctgct ccgcccccag cctgaggcgc catgtcagag ttaatcacga gggcatcaag cgagtttacc cctgcaggta ttgcacagag ggaaaacgca ccttcagcag ccgcctgatc ctagagaaac atgtccaggt ccggcacggc ttgcagcttg gggcccagtc ccctggccgg gggaccacct tggctcgggg ttccagtgcc agagcccagg ggccaggtcg gaaacgccgc cagtcttctg actcttgcag tgaggagcct gacagcacga caccgccagc caagtccccc aggggcggac ctggatctgg aggccatggc cctctgcgct accggagcag cagctccaca gaacagagcc tcatgatggg gttgagggtg gaggatggtg cccagcagtg cctcgactgt ggcttgtgct ttgcctcccc tggctccctg agccgacacc gtttcatcag ccacaagaag agacggggtg tgggtaaagc cagtgccctg gggctggggg atggggagga agaggcccct ccatcaaggt ctgaccccga tggtggagac tcacccctgc ctgcttctgg aggcccactg acctgtaagg tctgtggcaa gagctgcgac agccctctaa acctcaagac ccacttccgc acgcatggca tggcgttcat cagggctcgg cagggggctg ttggggacaa ctag. It is sometimes possible for the material contained within the vial of "ZNF687, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.