Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF549 cdna clone

ZNF549 cDNA Clone

Synonyms
ZNF549; ZNF549 cDNA Clone; ZNF549 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgaggcagcgctagtgaatacgccgcagattcccatggtaacagaagagtttgtgaaaccatcacagggccatgtgacctttgaggatattgctgtgtacttctcccaggaggagtggggcctccttgatgaagctcaaaggtgcctgtatcatgatgtgatgctggagaacttttcgcttatggcctcagtaggttgtttgcatggaatagaggctgaggaggccccttctgagcagactctttctgcgcaaggagtgtcacaggccaggactccaaagctaggtccttccatcccaaatgctcattcttgtgagatgtgtatcctggtcatgaaagacattttgtacctcagtgagcatcaggggacacttccctggcagaaaccttatacgtctgtggccagtgggaaatggttttcatttggttctaacctgcaacagcaccagaaccaggacagtggagagaaacacatcagaaaggaggagagcagtgccttgcttctgaatagctgcaaaattcctctgtcagacaatcttttcccatgcaaagatgttgagaaggattttccaaccatcctgggccttctccaacaccagaccacccacagcagacaagagtatgcacatagaagcagggagacctttcaacaaagacgttacaaatgtgagcaagttttcaatgagaaagttcatgttactgagcatcagagagtccacactggagaaaaagcttataagcgtagggaatatgggaaatccttgaactctaaatacttatttgttgaacaccagagaacccataatgcagaaaagccttatgtgtgcaatatatgtgggaaatcattcctccataaacaaacactcgttgggcaccagcagagaattcacactagagaaaggtcttatgtgtgcatcgaatgtgggaaatccttgagctccaaatactcacttgtggaacaccagagaacccataatggagaaaagccttatgtgtgcaatgtatgtgggaaatcattccgccacaaacaaacatttgttggccatcagcagagaatccacactggagagaggccttatgtgtgtatggaatgtgggaaatcttttattcattcctatgaccgcattcgacaccagagagttcacactggagaaggggcttatcagtgcagtgaatgtgggaaatccttcatatacaaacagtcacttcttgatcaccatagaatccacacgggagaaaggccttatgagtgcaaagaatgtgggaaggccttcattcacaaaaaaagacttcttgagcaccagagaattcatactggagaaaagccttatgtgtgcatcatatgtgggaaatcatttatccgctcgtctgactacatgcgacaccagagaattcacactggagaaagggcttatgaatgcagtgactgtgggaaagccttcatctccaaacaaacacttcttaagcatcacaaaatccacactagagaaaggccttatgaatgcagtgaatgtggaaaaggcttctaccttgaggttaaacttcttcagcaccaaagaatccatactagagaacaactttgtgagtgcaatgaatgtggaaaagtcttcagccaccaaaaaagacttcttgagcaccagaaagttcacactggcgaaaagccctgtgagtgcagtgaatgtgggaaatgctttagacaccgcaccagcctcattcaacaccagaaagttcacagtggagagaggccttataactgcactgcatgtgagaaggcctttatctataaaaacaaacttgttgagcatcagcgaatccacaccggagaaaagccgtatgaatgtggtaaatgtgggaaagccttcaacaaaagatattcccttgtcaggcaccagaaggtacatataacagaagagccctag
Sequence Length
1923
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,952 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 549, mRNA
NCBI Official Synonym Full Names
zinc finger protein 549
NCBI Official Symbol
ZNF549
NCBI Protein Information
zinc finger protein 549
UniProt Protein Name
Zinc finger protein 549
Protein Family
UniProt Gene Name
ZNF549
UniProt Entry Name
ZN549_HUMAN

Uniprot Description

ZNF549: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 19q13.43

Molecular Function: transcription factor activity

Biological Process: regulation of transcription, DNA-dependent

Similar Products

Product Notes

The ZNF549 znf549 (Catalog #AAA1278211) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgagg cagcgctagt gaatacgccg cagattccca tggtaacaga agagtttgtg aaaccatcac agggccatgt gacctttgag gatattgctg tgtacttctc ccaggaggag tggggcctcc ttgatgaagc tcaaaggtgc ctgtatcatg atgtgatgct ggagaacttt tcgcttatgg cctcagtagg ttgtttgcat ggaatagagg ctgaggaggc cccttctgag cagactcttt ctgcgcaagg agtgtcacag gccaggactc caaagctagg tccttccatc ccaaatgctc attcttgtga gatgtgtatc ctggtcatga aagacatttt gtacctcagt gagcatcagg ggacacttcc ctggcagaaa ccttatacgt ctgtggccag tgggaaatgg ttttcatttg gttctaacct gcaacagcac cagaaccagg acagtggaga gaaacacatc agaaaggagg agagcagtgc cttgcttctg aatagctgca aaattcctct gtcagacaat cttttcccat gcaaagatgt tgagaaggat tttccaacca tcctgggcct tctccaacac cagaccaccc acagcagaca agagtatgca catagaagca gggagacctt tcaacaaaga cgttacaaat gtgagcaagt tttcaatgag aaagttcatg ttactgagca tcagagagtc cacactggag aaaaagctta taagcgtagg gaatatggga aatccttgaa ctctaaatac ttatttgttg aacaccagag aacccataat gcagaaaagc cttatgtgtg caatatatgt gggaaatcat tcctccataa acaaacactc gttgggcacc agcagagaat tcacactaga gaaaggtctt atgtgtgcat cgaatgtggg aaatccttga gctccaaata ctcacttgtg gaacaccaga gaacccataa tggagaaaag ccttatgtgt gcaatgtatg tgggaaatca ttccgccaca aacaaacatt tgttggccat cagcagagaa tccacactgg agagaggcct tatgtgtgta tggaatgtgg gaaatctttt attcattcct atgaccgcat tcgacaccag agagttcaca ctggagaagg ggcttatcag tgcagtgaat gtgggaaatc cttcatatac aaacagtcac ttcttgatca ccatagaatc cacacgggag aaaggcctta tgagtgcaaa gaatgtggga aggccttcat tcacaaaaaa agacttcttg agcaccagag aattcatact ggagaaaagc cttatgtgtg catcatatgt gggaaatcat ttatccgctc gtctgactac atgcgacacc agagaattca cactggagaa agggcttatg aatgcagtga ctgtgggaaa gccttcatct ccaaacaaac acttcttaag catcacaaaa tccacactag agaaaggcct tatgaatgca gtgaatgtgg aaaaggcttc taccttgagg ttaaacttct tcagcaccaa agaatccata ctagagaaca actttgtgag tgcaatgaat gtggaaaagt cttcagccac caaaaaagac ttcttgagca ccagaaagtt cacactggcg aaaagccctg tgagtgcagt gaatgtggga aatgctttag acaccgcacc agcctcattc aacaccagaa agttcacagt ggagagaggc cttataactg cactgcatgt gagaaggcct ttatctataa aaacaaactt gttgagcatc agcgaatcca caccggagaa aagccgtatg aatgtggtaa atgtgggaaa gccttcaaca aaagatattc ccttgtcagg caccagaagg tacatataac agaagagccc tag. It is sometimes possible for the material contained within the vial of "ZNF549, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.