Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZKSCAN1 cdna clone

ZKSCAN1 cDNA Clone

Gene Names
ZKSCAN1; KOX18; ZNF36; PHZ-37; ZNF139; ZSCAN33; 9130423L19Rik
Synonyms
ZKSCAN1; ZKSCAN1 cDNA Clone; ZKSCAN1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgactgctgaatcacgggaagccacgggtctgtccccacaggctgcacaggagaaggatggtatcgtaatagcgaaggtggaagaggaagatgaggaagaccacatgtgggggcaggattccaccctacaggacacgcctcctccagacccagagatattccgccaacgcttcaggcgcttctgttaccagaacacttttgggccccgagaggctctcagtcggctgaaggaactttgtcatcagtggctgcggccagaaataaacaccaaggaacagatcctggagcttctggtgctagagcagtttctttccatcctgcccaaggagctccaggtctggctgcaggaataccgccccgatagtggagaggaggccgtgacccttctagaagacttggagcttgatttatcaggacaacaggtcccaggtcaagttcatggacctgagatgctcgcaagggggatggtgcctctggatccagttcaggagtcctcgagctttgaccttcatcacgaggccacccagtcccacttcaaacattcgtctcggaaaccccgcctcttacagtcacgagctcttcctgctgcccacattcctgcaccccctcatgagggtagtcccagagaccaggcgatggcatctgcactattcacagcggattcccaggcaatggtgaagatcgaggacatggctgtgtccctcattctggaggaatggggatgtcagaatctggctcggaggaatctcagtagggacaacaggcaggagaattatgggagcgcatttccccagggtggtgaaaacaggaatgagaacgaggagtcaacctcaaaggctgaaacctcggaagattcagcatcacgcggggagacaacaggaagatcccagaaagagtttggagagaaacgtgaccaggagggcaaaacaggagaaagacagcagaaaaaccctgaggagaaaaccaggaaagagaaaagagattcagggccagctataggaaaggacaaaaaaaccatcacaggagagagaggtccaagggagaaggggaaaggattgggaagaagcttcagtctgagctccaacttcaccacccctgaagaagttcccacgggaacaaagtctcacagatgtgatgaatgtggtaaatgcttcacgagaagttcaagccttatccgccataaaataatccacactggagaaaagccctatgaatgtagtgagtgtgggaaagccttcagtcttaactccaaccttgtcctgcatcagaggatccacacaggagagaaacctcatgaatgtaacgagtgtggcaaggccttcagccacagttccaatctcatcctccatcagcgcatccactctggagagaaaccttatgaatgtaatgagtgcgggaaggccttcagccagagctcggacctcaccaagcatcagagaattcacacgggggagaaaccctatgaatgtagtgaatgtggaaaagctttcaaccgaaactcatacctgattttgcatcggagaattcacactcgagaaaagccctacaagtgcactaagtgtggcaaggccttcacccgcagctccaccctcactctgcatcacagaatccatgccagagagagagcctctgagtacagcccagcctcccttgatgcatttggcgcgttcctgaaaagttgtgtgtaa
Sequence Length
1692
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,630 Da
NCBI Official Full Name
Homo sapiens zinc finger with KRAB and SCAN domains 1, mRNA
NCBI Official Synonym Full Names
zinc finger with KRAB and SCAN domains 1
NCBI Official Symbol
ZKSCAN1
NCBI Official Synonym Symbols
KOX18; ZNF36; PHZ-37; ZNF139; ZSCAN33; 9130423L19Rik
NCBI Protein Information
zinc finger protein with KRAB and SCAN domains 1
UniProt Protein Name
Zinc finger protein with KRAB and SCAN domains 1
UniProt Gene Name
ZKSCAN1
UniProt Synonym Gene Names
KOX18; ZNF139; ZNF36
UniProt Entry Name
ZKSC1_HUMAN

NCBI Description

The ZKSCAN1 gene encodes a transcriptional regulator of the KRAB (Kruppel-associated box) subfamily of zinc finger proteins, which contain repeated Cys2-His2 (C2H2) zinc finger domains that are connected by conserved sequences, called H/C links (summarized by Tommerup and Vissing, 1995 [PubMed 7557990]). Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. See ZNF91 (MIM 603971) for general information on zinc finger proteins.[supplied by OMIM, Jul 2010]

Uniprot Description

ZKSCAN1: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein; DNA-binding; Mitochondrial; Transcription factor

Chromosomal Location of Human Ortholog: 7q22

Cellular Component: nucleus

Molecular Function: protein binding; sequence-specific DNA binding; transcription factor activity

Research Articles on ZKSCAN1

Similar Products

Product Notes

The ZKSCAN1 zkscan1 (Catalog #AAA1278203) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgactg ctgaatcacg ggaagccacg ggtctgtccc cacaggctgc acaggagaag gatggtatcg taatagcgaa ggtggaagag gaagatgagg aagaccacat gtgggggcag gattccaccc tacaggacac gcctcctcca gacccagaga tattccgcca acgcttcagg cgcttctgtt accagaacac ttttgggccc cgagaggctc tcagtcggct gaaggaactt tgtcatcagt ggctgcggcc agaaataaac accaaggaac agatcctgga gcttctggtg ctagagcagt ttctttccat cctgcccaag gagctccagg tctggctgca ggaataccgc cccgatagtg gagaggaggc cgtgaccctt ctagaagact tggagcttga tttatcagga caacaggtcc caggtcaagt tcatggacct gagatgctcg caagggggat ggtgcctctg gatccagttc aggagtcctc gagctttgac cttcatcacg aggccaccca gtcccacttc aaacattcgt ctcggaaacc ccgcctctta cagtcacgag ctcttcctgc tgcccacatt cctgcacccc ctcatgaggg tagtcccaga gaccaggcga tggcatctgc actattcaca gcggattccc aggcaatggt gaagatcgag gacatggctg tgtccctcat tctggaggaa tggggatgtc agaatctggc tcggaggaat ctcagtaggg acaacaggca ggagaattat gggagcgcat ttccccaggg tggtgaaaac aggaatgaga acgaggagtc aacctcaaag gctgaaacct cggaagattc agcatcacgc ggggagacaa caggaagatc ccagaaagag tttggagaga aacgtgacca ggagggcaaa acaggagaaa gacagcagaa aaaccctgag gagaaaacca ggaaagagaa aagagattca gggccagcta taggaaagga caaaaaaacc atcacaggag agagaggtcc aagggagaag gggaaaggat tgggaagaag cttcagtctg agctccaact tcaccacccc tgaagaagtt cccacgggaa caaagtctca cagatgtgat gaatgtggta aatgcttcac gagaagttca agccttatcc gccataaaat aatccacact ggagaaaagc cctatgaatg tagtgagtgt gggaaagcct tcagtcttaa ctccaacctt gtcctgcatc agaggatcca cacaggagag aaacctcatg aatgtaacga gtgtggcaag gccttcagcc acagttccaa tctcatcctc catcagcgca tccactctgg agagaaacct tatgaatgta atgagtgcgg gaaggccttc agccagagct cggacctcac caagcatcag agaattcaca cgggggagaa accctatgaa tgtagtgaat gtggaaaagc tttcaaccga aactcatacc tgattttgca tcggagaatt cacactcgag aaaagcccta caagtgcact aagtgtggca aggccttcac ccgcagctcc accctcactc tgcatcacag aatccatgcc agagagagag cctctgagta cagcccagcc tcccttgatg catttggcgc gttcctgaaa agttgtgtgt aa. It is sometimes possible for the material contained within the vial of "ZKSCAN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.