Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MITF cdna clone

MITF cDNA Clone

Gene Names
MITF; MI; WS2; CMM8; WS2A; bHLHe32
Synonyms
MITF; MITF cDNA Clone; MITF cdna clone
Ordering
For Research Use Only!
Sequence
atgctggaaatgctagaatataatcactatcaggtgcagacccacctcgaaaaccccaccaagtaccacatacagcaagcccaacggcagcaggtaaagcagtacctttctaccactttagcaaataaacatgccaaccaagtcctgagcttgccatgtccaaaccagcctggcgatcatgtcatgccaccggtgccggggagcagcgcacccaacagccccatggctatgcttacgcttaactccaactgtgaaaaagagggattttataagtttgaagagcaaaacagggcagagagcgagtgcccaggcatgaacacacattcacgagcgtcctgtatgcagatggatgatgtaatcgatgacatcattagcctagaatcaagttataatgaggaaatcttgggcttgatggatcctgctttgcaaatggcaaatacgttgcctgtctcgggaaacttgattgatctttatggaaaccaaggtctgcccccaccaggcctcaccatcagcaactcctgtccagccaaccttcccaacataaaaagggagctcacagagtctgaagcaagagcactggccaaagagaggcagaaaaaggacaatcacaacctgattgaacgaagaagaagatttaacataaatgaccgcattaaagaactaggtactttgattcccaagtcaaatgatccagacatgcgctggaacaagggaaccatcttaaaagcatccgtggactatatccgaaagttgcaacgagaacagcaacgcgcaaaagaacttgaaaaccgacagaagaaactggagcacgccaaccggcatttgttgctcagaatacaggaacttgaaatgcaggctcgagctcatggactttcccttattccatccacgggtctctgctctccagatttggtgaatcggatcatcaagcaagaacccgttcttgagaactgcagccaagacctccttcagcatcatgcagacctaacctgtacaacaactctcgatctcacggatggcaccatcaccttcaacaacaacctcggaactgggactgaggccaaccaagcctatagtgtccccacaaaaatgggatccaaactggaagacatcctgatggacgacaccctttctcccgtcggtgtcactgatccactcctttcctcagtgtcccccggagcttccaaaacaagcagccggaggagcagtatgagcatggaagagacggagcacacttgttag
Sequence Length
1242
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,527 Da
NCBI Official Full Name
Homo sapiens microphthalmia-associated transcription factor, mRNA
NCBI Official Synonym Full Names
melanogenesis associated transcription factor
NCBI Official Symbol
MITF
NCBI Official Synonym Symbols
MI; WS2; CMM8; WS2A; bHLHe32
NCBI Protein Information
microphthalmia-associated transcription factor
UniProt Protein Name
Microphthalmia-associated transcription factor
UniProt Gene Name
MITF
UniProt Synonym Gene Names
BHLHE32; bHLHe32
UniProt Entry Name
MITF_HUMAN

NCBI Description

This gene encodes a transcription factor that contains both basic helix-loop-helix and leucine zipper structural features. It regulates the differentiation and development of melanocytes retinal pigment epithelium and is also responsible for pigment cell-specific transcription of the melanogenesis enzyme genes. Heterozygous mutations in the this gene cause auditory-pigmentary syndromes, such as Waardenburg syndrome type 2 and Tietz syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

MITF: a transcription factor that contains both basic helix-loop-helix and leucine zipper structural features. Plays a critical role in the differentiation of various cell types including neural crest- derived melanocytes, mast cells, osteoclasts and optic cup-derived retinal pigment epithelium. Two isoforms are known: the M-isoform is expressed exclusively in melanocytes, while the A-isoform has a much broader range of expression. Mutations in MITF can lead to Waardenburg syndrome. Ten alternatively spliced isoforms have been described.

Protein type: Transcription factor; Oncoprotein; DNA-binding

Chromosomal Location of Human Ortholog: 3p14.2-p14.1

Cellular Component: nucleoplasm; protein complex

Molecular Function: protein binding

Biological Process: melanocyte differentiation; negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; protein complex assembly; protein sumoylation

Disease: Albinism, Ocular, With Sensorineural Deafness; Melanoma, Cutaneous Malignant, Susceptibility To, 8; Tietz Syndrome; Waardenburg Syndrome, Type 2a

Research Articles on MITF

Similar Products

Product Notes

The MITF mitf (Catalog #AAA1278055) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggaaa tgctagaata taatcactat caggtgcaga cccacctcga aaaccccacc aagtaccaca tacagcaagc ccaacggcag caggtaaagc agtacctttc taccacttta gcaaataaac atgccaacca agtcctgagc ttgccatgtc caaaccagcc tggcgatcat gtcatgccac cggtgccggg gagcagcgca cccaacagcc ccatggctat gcttacgctt aactccaact gtgaaaaaga gggattttat aagtttgaag agcaaaacag ggcagagagc gagtgcccag gcatgaacac acattcacga gcgtcctgta tgcagatgga tgatgtaatc gatgacatca ttagcctaga atcaagttat aatgaggaaa tcttgggctt gatggatcct gctttgcaaa tggcaaatac gttgcctgtc tcgggaaact tgattgatct ttatggaaac caaggtctgc ccccaccagg cctcaccatc agcaactcct gtccagccaa ccttcccaac ataaaaaggg agctcacaga gtctgaagca agagcactgg ccaaagagag gcagaaaaag gacaatcaca acctgattga acgaagaaga agatttaaca taaatgaccg cattaaagaa ctaggtactt tgattcccaa gtcaaatgat ccagacatgc gctggaacaa gggaaccatc ttaaaagcat ccgtggacta tatccgaaag ttgcaacgag aacagcaacg cgcaaaagaa cttgaaaacc gacagaagaa actggagcac gccaaccggc atttgttgct cagaatacag gaacttgaaa tgcaggctcg agctcatgga ctttccctta ttccatccac gggtctctgc tctccagatt tggtgaatcg gatcatcaag caagaacccg ttcttgagaa ctgcagccaa gacctccttc agcatcatgc agacctaacc tgtacaacaa ctctcgatct cacggatggc accatcacct tcaacaacaa cctcggaact gggactgagg ccaaccaagc ctatagtgtc cccacaaaaa tgggatccaa actggaagac atcctgatgg acgacaccct ttctcccgtc ggtgtcactg atccactcct ttcctcagtg tcccccggag cttccaaaac aagcagccgg aggagcagta tgagcatgga agagacggag cacacttgtt ag. It is sometimes possible for the material contained within the vial of "MITF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.