C1QTNF2 cdna clone
C1QTNF2 cDNA Clone
Gene Names
C1QTNF2; CTRP2; zacrp2
Synonyms
C1QTNF2; C1QTNF2 cDNA Clone; C1QTNF2 cdna clone
Sequence
atgatcccctgggtgctcctggcctgtgccctcccctgtgctgctgacccactgcttggcgcctttgctcgcagggacttccggaaaggctcccctcaactggtctgcagcctgcctggcccccagggcccacccggccccccaggagccccagggccctcaggaatgatgggacgaatgggctttcctggcaaagacggccaagatggacacgacggcgaccggggggacagcggagaggaaggtccacctggccggacaggtaaccggggaaagccaggaccaaagggcaaagccggggccattgggcgggctggcccccgtggccccaagggggtcaacggtacccccgggaagcatggcacaccaggcaagaaggggcccaagggcaagaagggggagccaggcctcccaggcccctgcagctgtggcagtggccataccaagtcagctttctcggtggcagtgaccaagagctacccacgggagcggctgcccatcaagtttgacaagattctgatgaacgagggtggccactacaatgcttccagcggcaagttcgtctgcggcgtgcctgggatctactacttcacctacgacatcacgctggccaacaagcacctggccatcggcctggtgcacaacggccagtaccgcatccggacctttgatgccaacaccggcaaccacgatgtggcctcaggctccaccatcctggctctcaagcagggtgacgaagtttggctgcagatcttctactcagagcagaacgggctcttctatgacccttactggacagacagcctctttacgggcttcctaatctatgccgaccaggatgaccccaacgaggtatag
Sequence Length
858
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,952 Da
NCBI Official Full Name
Homo sapiens C1q and tumor necrosis factor related protein 2, mRNA
NCBI Official Synonym Full Names
C1q and tumor necrosis factor related protein 2
NCBI Official Symbol
C1QTNF2
NCBI Official Synonym Symbols
CTRP2; zacrp2
NCBI Protein Information
complement C1q tumor necrosis factor-related protein 2
UniProt Protein Name
Complement C1q tumor necrosis factor-related protein 2
Protein Family
UniProt Gene Name
C1QTNF2
UniProt Synonym Gene Names
CTRP2
UniProt Entry Name
C1QT2_HUMAN
Uniprot Description
C1QTNF2: May interact with FAM132B
Protein type: Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 5q33.3
Molecular Function: protein binding
Similar Products
Product Notes
The C1QTNF2 c1qtnf2 (Catalog #AAA1277980) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcccct gggtgctcct ggcctgtgcc ctcccctgtg ctgctgaccc actgcttggc gcctttgctc gcagggactt ccggaaaggc tcccctcaac tggtctgcag cctgcctggc ccccagggcc cacccggccc cccaggagcc ccagggccct caggaatgat gggacgaatg ggctttcctg gcaaagacgg ccaagatgga cacgacggcg accgggggga cagcggagag gaaggtccac ctggccggac aggtaaccgg ggaaagccag gaccaaaggg caaagccggg gccattgggc gggctggccc ccgtggcccc aagggggtca acggtacccc cgggaagcat ggcacaccag gcaagaaggg gcccaagggc aagaaggggg agccaggcct cccaggcccc tgcagctgtg gcagtggcca taccaagtca gctttctcgg tggcagtgac caagagctac ccacgggagc ggctgcccat caagtttgac aagattctga tgaacgaggg tggccactac aatgcttcca gcggcaagtt cgtctgcggc gtgcctggga tctactactt cacctacgac atcacgctgg ccaacaagca cctggccatc ggcctggtgc acaacggcca gtaccgcatc cggacctttg atgccaacac cggcaaccac gatgtggcct caggctccac catcctggct ctcaagcagg gtgacgaagt ttggctgcag atcttctact cagagcagaa cgggctcttc tatgaccctt actggacaga cagcctcttt acgggcttcc taatctatgc cgaccaggat gaccccaacg aggtatag. It is sometimes possible for the material contained within the vial of "C1QTNF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
