Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEPSECS cdna clone

SEPSECS cDNA Clone

Gene Names
SEPSECS; LP; SLA; PCH2D; SLA/LP
Synonyms
SEPSECS; SEPSECS cDNA Clone; SEPSECS cdna clone
Ordering
For Research Use Only!
Sequence
atggacagcaacaatttcttaggcaattgtggtgtgggagaaagggaagggagagtggcatccgcactggttgctcgtcgtcattacaggttcattcatggcattggacgatccggtgatatttctgctgtgcaaccaaaagctgcaggctctagccttttgaacaaaattaccaattctttggtcctggacattataaagctggctggtgtccatacagtagccaactgctttgtagttcctatggcaactggtatgagtctaactctgtgtttcttaacattacgacacaaaagaccaaaggcaaagtatattatatggccacgaatagaccagaagtcctgctttaaatccatgatcactgcaggttttgagcctgtggtgatagaaaatgttttggaaggtgacgagctgcgtacagacctgaaagcagtggaggctaaagtccaggaacttgggcctgattgcattctgtgtattcattctactacatcctgttttgctccaagggtgcctgatagattagaagaactggctgtgatttgtgctaattatgacattccacatatagttaataatgcttatggagtgcagtcttcaaagtgtatgcatctcattcagcagggggctcgagttggtagaatagatgcttttgttcagagcttggacaaaaattttatggttccagtaggtggtgctataattgctggctttaatgattcattcattcaggaaatcagcaagatgtatccaggaagagcttcagcttcaccttctttagatgtccttattactttattgtcacttggatcaaatggctataagaagctactaaaagaaagaaaggaaatgttttcatatttgtccaaccaaataaagaagttgtcagaagcctacaatgaaagactgttgcatacacctcacaatcccatatctttagctatgacacttaaaacactagatgaacaccgtgacaaagctgtcactcagcttggctcgatgctttttaccagacaggtttctggagccagggttgtgcctcttgggtccatgcaaactgtgagtggctatactttcagaggctttatgtcacatacaaataattacccttgtgcttacctcaatgctgcatcagccatcggaatgaagatgcaggatgtggacctgttcataaagagacttgacaggtgtttaaaggcagtaagaaaagaacgaagtaaagagagtgatgacaattatgacaaaactgaagatgtggatattgaagaaatggctttaaaactagataatgtacttcttgacacataccaggatgcttcttcatga
Sequence Length
1326
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,411 Da
NCBI Official Full Name
Homo sapiens Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase, mRNA
NCBI Official Synonym Full Names
Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
NCBI Official Symbol
SEPSECS
NCBI Official Synonym Symbols
LP; SLA; PCH2D; SLA/LP
NCBI Protein Information
O-phosphoseryl-tRNA(Sec) selenium transferase
UniProt Protein Name
O-phosphoseryl-tRNA(Sec) selenium transferase
UniProt Gene Name
SEPSECS
UniProt Synonym Gene Names
TRNP48; LP; Sec synthase; SepSecS; SLA
UniProt Entry Name
SPCS_HUMAN

NCBI Description

The amino acid selenocysteine is the only amino acid that does not have its own tRNA synthetase. Instead, this amino acid is synthesized on its cognate tRNA in a three step process. The protein encoded by this gene catalyzes the third step in the process, the conversion of O-phosphoseryl-tRNA(Sec) to selenocysteinyl-tRNA(Sec).[provided by RefSeq, Mar 2011]

Uniprot Description

SLA/LP: Converts O-phosphoseryl-tRNA(Sec) to selenocysteinyl- tRNA(Sec) required for selenoprotein biosynthesis. Defects in SEPSECS are the cause of pontocerebellar hypoplasia type 2D (PCH2D). PCH2D is a disorder characterized by postnatal onset of progressive atrophy of the cerebrum and cerebellum, microcephaly, profound mental retardation, spasticity, and variable seizures. Belongs to the SepSecS family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.9.1.2; RNA-binding; Transferase

Chromosomal Location of Human Ortholog: 4p15.2

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: protein binding; tRNA binding

Biological Process: selenocysteine incorporation; selenocysteine metabolic process

Disease: Pontocerebellar Hypoplasia, Type 2d

Research Articles on SEPSECS

Similar Products

Product Notes

The SEPSECS sepsecs (Catalog #AAA1277322) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacagca acaatttctt aggcaattgt ggtgtgggag aaagggaagg gagagtggca tccgcactgg ttgctcgtcg tcattacagg ttcattcatg gcattggacg atccggtgat atttctgctg tgcaaccaaa agctgcaggc tctagccttt tgaacaaaat taccaattct ttggtcctgg acattataaa gctggctggt gtccatacag tagccaactg ctttgtagtt cctatggcaa ctggtatgag tctaactctg tgtttcttaa cattacgaca caaaagacca aaggcaaagt atattatatg gccacgaata gaccagaagt cctgctttaa atccatgatc actgcaggtt ttgagcctgt ggtgatagaa aatgttttgg aaggtgacga gctgcgtaca gacctgaaag cagtggaggc taaagtccag gaacttgggc ctgattgcat tctgtgtatt cattctacta catcctgttt tgctccaagg gtgcctgata gattagaaga actggctgtg atttgtgcta attatgacat tccacatata gttaataatg cttatggagt gcagtcttca aagtgtatgc atctcattca gcagggggct cgagttggta gaatagatgc ttttgttcag agcttggaca aaaattttat ggttccagta ggtggtgcta taattgctgg ctttaatgat tcattcattc aggaaatcag caagatgtat ccaggaagag cttcagcttc accttcttta gatgtcctta ttactttatt gtcacttgga tcaaatggct ataagaagct actaaaagaa agaaaggaaa tgttttcata tttgtccaac caaataaaga agttgtcaga agcctacaat gaaagactgt tgcatacacc tcacaatccc atatctttag ctatgacact taaaacacta gatgaacacc gtgacaaagc tgtcactcag cttggctcga tgctttttac cagacaggtt tctggagcca gggttgtgcc tcttgggtcc atgcaaactg tgagtggcta tactttcaga ggctttatgt cacatacaaa taattaccct tgtgcttacc tcaatgctgc atcagccatc ggaatgaaga tgcaggatgt ggacctgttc ataaagagac ttgacaggtg tttaaaggca gtaagaaaag aacgaagtaa agagagtgat gacaattatg acaaaactga agatgtggat attgaagaaa tggctttaaa actagataat gtacttcttg acacatacca ggatgcttct tcatga. It is sometimes possible for the material contained within the vial of "SEPSECS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.