Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARL11 cdna clone

ARL11 cDNA Clone

Gene Names
ARL11; ARLTS1
Synonyms
ARL11; ARL11 cDNA Clone; ARL11 cdna clone
Ordering
For Research Use Only!
Sequence
atgggttctgtgaattccagaggtcacaaggcggaagcccaggtggtgatgatgggcctggactcggcgggcaagaccacgctcctttacaagctgaagggccaccagctggtggagaccctgcccactgttggtttcaacgtggagcctctgaaagctcctgggcacgtgtcactgactctctgggacgttggggggcaggccccgctcagagccagctggaaggactatctggaaggcacagatatcctcgtgtacgtgctggacagcacagatgaagcccgcttacccgagtcggcggctgagctcacagaagtcctgaacgaccccaacatggctggcgtccccttcttggtgctggccaacaagcaggaggcacctgatgcacttccgctgcttaagatcagaaacaggctgagtctagagagattccaggaccactgctgggagctccggggctgcagtgccctcactggggaggggctgcccgaggccctgcagagcctgtggagcctcctgaaatctcgcagctgcatgtgtctgcaggcgagagcccatggggctgagcgcggagacagcaagagatcttga
Sequence Length
591
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,391 Da
NCBI Official Full Name
Homo sapiens ADP-ribosylation factor-like 11, mRNA
NCBI Official Synonym Full Names
ADP ribosylation factor like GTPase 11
NCBI Official Symbol
ARL11
NCBI Official Synonym Symbols
ARLTS1
NCBI Protein Information
ADP-ribosylation factor-like protein 11
UniProt Protein Name
ADP-ribosylation factor-like protein 11
UniProt Gene Name
ARL11
UniProt Synonym Gene Names
ARLTS1
UniProt Entry Name
ARL11_HUMAN

NCBI Description

This gene encodes a tumor suppressor related to the ADP-ribosylation factor (ARF) family of proteins. The encoded protein may play a role in apoptosis in a caspase-dependent manner. Polymorphisms in this gene have been associated with some familial cancers. [provided by RefSeq, May 2010]

Uniprot Description

ARL11: May play a role in apoptosis. May act as a tumor suppressor. Defects in ARL11 may be a cause of susceptibility to chronic lymphocytic leukemia (CLL). Belongs to the small GTPase superfamily. Arf family.

Protein type: G protein, monomeric; G protein, monomeric, ARF

Chromosomal Location of Human Ortholog: 13q14.2

Molecular Function: protein binding

Disease: Leukemia, Chronic Lymphocytic

Research Articles on ARL11

Similar Products

Product Notes

The ARL11 arl11 (Catalog #AAA1277168) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggttctg tgaattccag aggtcacaag gcggaagccc aggtggtgat gatgggcctg gactcggcgg gcaagaccac gctcctttac aagctgaagg gccaccagct ggtggagacc ctgcccactg ttggtttcaa cgtggagcct ctgaaagctc ctgggcacgt gtcactgact ctctgggacg ttggggggca ggccccgctc agagccagct ggaaggacta tctggaaggc acagatatcc tcgtgtacgt gctggacagc acagatgaag cccgcttacc cgagtcggcg gctgagctca cagaagtcct gaacgacccc aacatggctg gcgtcccctt cttggtgctg gccaacaagc aggaggcacc tgatgcactt ccgctgctta agatcagaaa caggctgagt ctagagagat tccaggacca ctgctgggag ctccggggct gcagtgccct cactggggag gggctgcccg aggccctgca gagcctgtgg agcctcctga aatctcgcag ctgcatgtgt ctgcaggcga gagcccatgg ggctgagcgc ggagacagca agagatcttg a. It is sometimes possible for the material contained within the vial of "ARL11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.