Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINE1 cdna clone

SERPINE1 cDNA Clone

Gene Names
SERPINE1; PAI; PAI1; PAI-1; PLANH1
Synonyms
SERPINE1; SERPINE1 cDNA Clone; SERPINE1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagatgtctccagccctcacctgcctagtcctgggcctggcccttgtctttggtgaagggtctgctgtgcaccatcccccatcctacgtggcccacctggcctcagacttcggggtgagggtgtttcagcaggtggcgcaggcctccaaggaccgcaacgtggttttctcaccctatggggtggcctcggtgttggccatgctccagctgacaacaggaggagaaacccagcagcagattcaagcagctatgggattcaagattgatgacaagggcatggcccccgccctccggcatctgtacaaggagctcatggggccatggaacaaggatgagatcagcaccacagacgcgatcttcgtccagcgggatctgaagctggtccagggcttcatgccccacttcttcaggctgttccggagcacggtcaagcaagtggacttttcagaggtggagagagccagattcatcatcaatgactgggtgaagacacacacaaaaggtatgatcagcaacttgcttgggaaaggagccgtggaccagctgacacggctggtgctggtgaatgccctctacttcaacggccagtggaagactcccttccccgactccagcacccaccgccgcctcttccacaaatcagacggcagcactgtctctgtgcccatgatggctcagaccaacaagttcaactatactgagttcaccacgcccgatggccattactacgacatcctggaactgccctaccacggggacaccctcagcatgttcattgctgccccttatgaaaaagaggtgcctctctctgccctcaccaacattctgagtgcccagctcatcagccactggaaaggcaacatgaccaggctgccccgcctcctggttctgcccaagttctccctggagactgaagtcgacctcaggaagcccctagagaacctgggaatgaccgacatgttcagacagtttcaggctgacttcacgagtctttcagaccaagagcctctccacgtcgcgcaggcgctgcagaaagtgaagatcgaggtgaacgagagtggcacggtggcctcctcatccacagctgtcatagtctcagcccgcatggcccccgaggagatcatcatggacagacccttcctctttgtggtccggcacaaccccacaggaacagtccttttcatgggccaagtgatggaaccctga
Sequence Length
1209
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,404 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1, mRNA
NCBI Official Synonym Full Names
serpin family E member 1
NCBI Official Symbol
SERPINE1
NCBI Official Synonym Symbols
PAI; PAI1; PAI-1; PLANH1
NCBI Protein Information
plasminogen activator inhibitor 1
UniProt Protein Name
Plasminogen activator inhibitor 1
UniProt Gene Name
SERPINE1
UniProt Synonym Gene Names
PAI1; PLANH1; PAI; PAI-1
UniProt Entry Name
PAI1_HUMAN

NCBI Description

This gene encodes a member of the serine proteinase inhibitor (serpin) superfamily. This member is the principal inhibitor of tissue plasminogen activator (tPA) and urokinase (uPA), and hence is an inhibitor of fibrinolysis. Defects in this gene are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency), and high concentrations of the gene product are associated with thrombophilia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Uniprot Description

SERPINE1: a secreted protein that acts as 'bait' for tissue plasminogen activator, urokinase, and protein C. Its rapid interaction with TPA may function as a major control point in the regulation of fibrinolysis. Belongs to the serpin family. Interacts with VTN. Binds LRP1B; binding is followed by internalization and degradation. Plasma levels of PAI-1 and VCAM-1 together may be useful in predicting post-operative recurrence in patients with colorectal cancer.

Protein type: Secreted, signal peptide; Motility/polarity/chemotaxis; Secreted

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: extracellular matrix; extracellular region; extracellular space; plasma membrane

Molecular Function: protease binding; protein binding; receptor binding; serine-type endopeptidase inhibitor activity

Biological Process: angiogenesis; chronological cell aging; circadian rhythm; defense response to Gram-negative bacterium; extracellular matrix organization and biogenesis; fibrinolysis; negative regulation of blood coagulation; negative regulation of cell adhesion mediated by integrin; negative regulation of cell migration; negative regulation of fibrinolysis; negative regulation of smooth muscle cell migration; platelet degranulation; positive regulation of angiogenesis; positive regulation of blood coagulation; positive regulation of inflammatory response; positive regulation of interleukin-8 production; positive regulation of receptor-mediated endocytosis; positive regulation of transcription from RNA polymerase II promoter; regulation of receptor activity

Disease: Plasminogen Activator Inhibitor-1 Deficiency

Research Articles on SERPINE1

Similar Products

Product Notes

The SERPINE1 serpine1 (Catalog #AAA1276990) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagatgt ctccagccct cacctgccta gtcctgggcc tggcccttgt ctttggtgaa gggtctgctg tgcaccatcc cccatcctac gtggcccacc tggcctcaga cttcggggtg agggtgtttc agcaggtggc gcaggcctcc aaggaccgca acgtggtttt ctcaccctat ggggtggcct cggtgttggc catgctccag ctgacaacag gaggagaaac ccagcagcag attcaagcag ctatgggatt caagattgat gacaagggca tggcccccgc cctccggcat ctgtacaagg agctcatggg gccatggaac aaggatgaga tcagcaccac agacgcgatc ttcgtccagc gggatctgaa gctggtccag ggcttcatgc cccacttctt caggctgttc cggagcacgg tcaagcaagt ggacttttca gaggtggaga gagccagatt catcatcaat gactgggtga agacacacac aaaaggtatg atcagcaact tgcttgggaa aggagccgtg gaccagctga cacggctggt gctggtgaat gccctctact tcaacggcca gtggaagact cccttccccg actccagcac ccaccgccgc ctcttccaca aatcagacgg cagcactgtc tctgtgccca tgatggctca gaccaacaag ttcaactata ctgagttcac cacgcccgat ggccattact acgacatcct ggaactgccc taccacgggg acaccctcag catgttcatt gctgcccctt atgaaaaaga ggtgcctctc tctgccctca ccaacattct gagtgcccag ctcatcagcc actggaaagg caacatgacc aggctgcccc gcctcctggt tctgcccaag ttctccctgg agactgaagt cgacctcagg aagcccctag agaacctggg aatgaccgac atgttcagac agtttcaggc tgacttcacg agtctttcag accaagagcc tctccacgtc gcgcaggcgc tgcagaaagt gaagatcgag gtgaacgaga gtggcacggt ggcctcctca tccacagctg tcatagtctc agcccgcatg gcccccgagg agatcatcat ggacagaccc ttcctctttg tggtccggca caaccccaca ggaacagtcc ttttcatggg ccaagtgatg gaaccctga. It is sometimes possible for the material contained within the vial of "SERPINE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.