Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF821 cdna clone

ZNF821 cDNA Clone

Synonyms
ZNF821; ZNF821 cDNA Clone; ZNF821 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcccgtcggaaacagacaaatccaaataaagttcactgtgacagtgagggtgatgaagaggagacgacacaagatgaagtctcttcccacacatcagaggaagatggaggggtggtcaaagtggagaaagagttagaaaatacagaacagcctgttggtgggaacgaagtggtagagcacgaggtcacagggaatttgaattctgaccccttgcttgaactctgccagtgtcccctctgccagctagactgcgggagccgggagcagttgattgctcacgtgtaccagcacactgcagcagtggtgagcgccaagagctacatgtgtcctgtctgtggccgggcccttagctccccggggtcattgggtcgccacctcttaatccactcggaggaccagcgatctaactgtgctgtgtgtggagcccggttcaccagccatgccacttttaacagtgagaaacttcctgaagtactaaatatggaatccctacccacagtccacaatgagggtccctccagtgctgaggggaaggatattgcctttagtcctccagtgtaccctgctggaattctgcttgtgtgcaacaactgtgctgcctaccgtaaactgctggaagcccagactcccagtgtacgcaagtgggctctacgtcgacagaatgagcctttggaagtacggctgcagcggctggaacgagagcgcacggccaagaagagccggcgggacaatgagacccccgaggagcgggaggtgaggcgcatgagggaccgtgaagccaagcgcttgcagcgcatgcaggagacagacgagcagcgggcacgccggctgcagcgggatcgggaggccatgaggctgaagcgggccaatgaaaccccggaaaagcggcaggcccggctcatccgagagcgagaggccaagcggctcaagaggaggctggagaaaatggacatgatgttgcgagctcagtttggccaggacccttctgccatggcagccttagcagctgaaatgaacttcttccagctgcctgtaagtggggtggagttagacagccagcttctgggcaagatggcctttgaagagcagaacagcagctctctgcactga
Sequence Length
1113
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,140 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 821, mRNA
NCBI Official Synonym Full Names
zinc finger protein 821
NCBI Official Symbol
ZNF821
NCBI Protein Information
zinc finger protein 821
UniProt Protein Name
Zinc finger protein 821
Protein Family
UniProt Gene Name
ZNF821
UniProt Entry Name
ZN821_HUMAN

NCBI Description

This gene encodes a protein with two C2H2 zinc finger motifs and a score-and-three (23)-amino acid peptide repeat (STPR) domain. The STPR domain of the encoded protein binds to double stranded DNA and may also contain a nuclear localization signal, suggesting that this protein interacts with chromosomal DNA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

ZNF821: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 16q22.2

Molecular Function: protein binding; transcription factor activity

Biological Process: positive regulation of transcription from RNA polymerase II promoter

Research Articles on ZNF821

Similar Products

Product Notes

The ZNF821 znf821 (Catalog #AAA1276844) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccgtc ggaaacagac aaatccaaat aaagttcact gtgacagtga gggtgatgaa gaggagacga cacaagatga agtctcttcc cacacatcag aggaagatgg aggggtggtc aaagtggaga aagagttaga aaatacagaa cagcctgttg gtgggaacga agtggtagag cacgaggtca cagggaattt gaattctgac cccttgcttg aactctgcca gtgtcccctc tgccagctag actgcgggag ccgggagcag ttgattgctc acgtgtacca gcacactgca gcagtggtga gcgccaagag ctacatgtgt cctgtctgtg gccgggccct tagctccccg gggtcattgg gtcgccacct cttaatccac tcggaggacc agcgatctaa ctgtgctgtg tgtggagccc ggttcaccag ccatgccact tttaacagtg agaaacttcc tgaagtacta aatatggaat ccctacccac agtccacaat gagggtccct ccagtgctga ggggaaggat attgccttta gtcctccagt gtaccctgct ggaattctgc ttgtgtgcaa caactgtgct gcctaccgta aactgctgga agcccagact cccagtgtac gcaagtgggc tctacgtcga cagaatgagc ctttggaagt acggctgcag cggctggaac gagagcgcac ggccaagaag agccggcggg acaatgagac ccccgaggag cgggaggtga ggcgcatgag ggaccgtgaa gccaagcgct tgcagcgcat gcaggagaca gacgagcagc gggcacgccg gctgcagcgg gatcgggagg ccatgaggct gaagcgggcc aatgaaaccc cggaaaagcg gcaggcccgg ctcatccgag agcgagaggc caagcggctc aagaggaggc tggagaaaat ggacatgatg ttgcgagctc agtttggcca ggacccttct gccatggcag ccttagcagc tgaaatgaac ttcttccagc tgcctgtaag tggggtggag ttagacagcc agcttctggg caagatggcc tttgaagagc agaacagcag ctctctgcac tga. It is sometimes possible for the material contained within the vial of "ZNF821, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.