ZNF266 cdna clone
ZNF266 cDNA Clone
Gene Names
ZNF266; HZF1
Synonyms
ZNF266; ZNF266 cDNA Clone; ZNF266 cdna clone
Sequence
atgaaaatccatgtgggtgagaagccttatgaatgcaaggaatgtgggatagccttcactagatcttctcaacttactgaacatttaaaaactcacactgcaaaggatccctttgaatgtaagatatgtggaaaatcctttagaaattcctcatgcctcagtgatcactttcgaattcacactggaataaaaccctataaatgtaaggattgtgggaaagccttcactcagaactcagaccttactaagcatgcacgaactcacagtggagagaggccctatgaatgtaaggaatgtggaaaggcctttgccagatcctctcgccttagtgaacatacaagaactcacactggagagaagccttttgaatgtgtcaaatgtgggaaagcctttgctatttcttcaaatcttagtggacatttgagaattcacactggagagaagccctttgagtgcctggaatgtggtaaagcatttacgcattcctccagtcttaataatcacatgcggacccacagcgccaaaaaaccattcacgtgtatggaatgtggcaaagcctttaagtttcccacgtgtgttaaccttcacatgcggatccacactggagaaaaaccctacaaatgtaaacagtgtgggaaatccttcagttactccaattcgtttcagttacatgaacgaactcacactggagagaaaccctatgaatgtaaggagtgcgggaaagccttcagttcttccagttcctttcgaaatcatgaaagaaggcatgcggatgagagactgtcagcataa
Sequence Length
792
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
62,116 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 266, mRNA
NCBI Official Synonym Full Names
zinc finger protein 266
NCBI Official Symbol
ZNF266
NCBI Official Synonym Symbols
HZF1
NCBI Protein Information
zinc finger protein 266
UniProt Protein Name
Zinc finger protein 266
Protein Family
UniProt Gene Name
ZNF266
UniProt Synonym Gene Names
KIAA2007
UniProt Entry Name
ZN266_HUMAN
NCBI Description
This gene encodes a protein containing many tandem zinc-finger motifs. Zinc fingers are protein or nucleic acid-binding domains, and may be involved in a variety of functions, including regulation of transcription. This gene is located in a cluster of similar genes encoding zinc finger proteins on chromosome 19. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Sep 2012]
Uniprot Description
ZNF266: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 19p13.2
Molecular Function: protein binding
Research Articles on ZNF266
Similar Products
Product Notes
The ZNF266 znf266 (Catalog #AAA1276338) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaatcc atgtgggtga gaagccttat gaatgcaagg aatgtgggat agccttcact agatcttctc aacttactga acatttaaaa actcacactg caaaggatcc ctttgaatgt aagatatgtg gaaaatcctt tagaaattcc tcatgcctca gtgatcactt tcgaattcac actggaataa aaccctataa atgtaaggat tgtgggaaag ccttcactca gaactcagac cttactaagc atgcacgaac tcacagtgga gagaggccct atgaatgtaa ggaatgtgga aaggcctttg ccagatcctc tcgccttagt gaacatacaa gaactcacac tggagagaag ccttttgaat gtgtcaaatg tgggaaagcc tttgctattt cttcaaatct tagtggacat ttgagaattc acactggaga gaagcccttt gagtgcctgg aatgtggtaa agcatttacg cattcctcca gtcttaataa tcacatgcgg acccacagcg ccaaaaaacc attcacgtgt atggaatgtg gcaaagcctt taagtttccc acgtgtgtta accttcacat gcggatccac actggagaaa aaccctacaa atgtaaacag tgtgggaaat ccttcagtta ctccaattcg tttcagttac atgaacgaac tcacactgga gagaaaccct atgaatgtaa ggagtgcggg aaagccttca gttcttccag ttcctttcga aatcatgaaa gaaggcatgc ggatgagaga ctgtcagcat aa. It is sometimes possible for the material contained within the vial of "ZNF266, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
