ZNF187 cdna clone
ZNF187 cDNA Clone
Gene Names
ZSCAN26; SREZBP; ZNF187; SRE-ZBP
Synonyms
ZNF187; ZNF187 cDNA Clone; ZNF187 cdna clone
Sequence
atggcccctctgaaaggagtacaggaacagcaggttcggcatgagtgtgaagttacaaagcctgagaaagagaagggtgaggagacaaggattgagaatgggaagcttattgtagtaacagactcttgtggaagagtagagtcatctgggaaaatatctgaacccatggaggctcataatgagggctctaacttggaaagtcatcaggccaagcccaaagagaagattgagtataaatgctcagaacgtgagcagagattcatccagcacttggacctgattgaacatgcgagtacacacacgggaaagaaactctgcgagtctgatgtgtgtcagagttccagtcttacaggacataagaaagtcctctctagagagaaaggtcatcagtgtcatgagtgtgggaaagcctttcagaggagttcacacctcgtcagacatcagaaaatccatcttggtgagaagccttatcagtgcaatgagtgtggcaaagtctttagccagaatgcaggccttttggaacatctcagaattcatactggagagaaaccttatctatgtatccattgtggaaaaaattttaggcgcagctctcaccttaatcgacatcagagaattcacagtcaggaggagccctgtgagtgcaaggagtgtggaaaaacctttagtcaggccttactcctcacccaccatcagagaatccatagtcactccaaaagccatcaatgtaacgagtgtggaaaagctttcagtttgacctcagaccttattcgacaccacagaattcatactggagaaaaacctttcaagtgtaacatatgccagaaagccttccgactaaactcacaccttgctcagcatgtaagaatccacaatgaagaaaaaccctatcagtgtagtgaatgtggagaagccttcaggcaaaggtcaggtctttttcaacatcagagatatcaccacaaagacaaactggcttga
Sequence Length
978
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,560 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 187, mRNA
NCBI Official Synonym Full Names
zinc finger and SCAN domain containing 26
NCBI Official Symbol
ZSCAN26
NCBI Official Synonym Symbols
SREZBP; ZNF187; SRE-ZBP
NCBI Protein Information
zinc finger and SCAN domain-containing protein 26
UniProt Protein Name
Zinc finger and SCAN domain-containing protein 26
UniProt Gene Name
ZSCAN26
UniProt Synonym Gene Names
ZNF187
UniProt Entry Name
ZSC26_HUMAN
Uniprot Description
ZNF187: May be involved in transcriptional regulation (Probable). 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription factor; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 6p21.31
Cellular Component: cytoplasm; nucleoplasm; nucleus
Molecular Function: protein binding; sequence-specific DNA binding; transcription factor activity
Similar Products
Product Notes
The ZNF187 zscan26 (Catalog #AAA1276274) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccctc tgaaaggagt acaggaacag caggttcggc atgagtgtga agttacaaag cctgagaaag agaagggtga ggagacaagg attgagaatg ggaagcttat tgtagtaaca gactcttgtg gaagagtaga gtcatctggg aaaatatctg aacccatgga ggctcataat gagggctcta acttggaaag tcatcaggcc aagcccaaag agaagattga gtataaatgc tcagaacgtg agcagagatt catccagcac ttggacctga ttgaacatgc gagtacacac acgggaaaga aactctgcga gtctgatgtg tgtcagagtt ccagtcttac aggacataag aaagtcctct ctagagagaa aggtcatcag tgtcatgagt gtgggaaagc ctttcagagg agttcacacc tcgtcagaca tcagaaaatc catcttggtg agaagcctta tcagtgcaat gagtgtggca aagtctttag ccagaatgca ggccttttgg aacatctcag aattcatact ggagagaaac cttatctatg tatccattgt ggaaaaaatt ttaggcgcag ctctcacctt aatcgacatc agagaattca cagtcaggag gagccctgtg agtgcaagga gtgtggaaaa acctttagtc aggccttact cctcacccac catcagagaa tccatagtca ctccaaaagc catcaatgta acgagtgtgg aaaagctttc agtttgacct cagaccttat tcgacaccac agaattcata ctggagaaaa acctttcaag tgtaacatat gccagaaagc cttccgacta aactcacacc ttgctcagca tgtaagaatc cacaatgaag aaaaacccta tcagtgtagt gaatgtggag aagccttcag gcaaaggtca ggtctttttc aacatcagag atatcaccac aaagacaaac tggcttga. It is sometimes possible for the material contained within the vial of "ZNF187, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
