WBSCR17 cdna clone
WBSCR17 cDNA Clone
Gene Names
WBSCR17; GALNT16; GALNT20; GALNTL3; GALNACT17; GalNAc-T5L
Synonyms
WBSCR17; WBSCR17 cDNA Clone; WBSCR17 cdna clone
Sequence
atggcttcactgagaagagtcaaagtgctgttggtgttgaacttgatcgcggtagccggcttcgtgctcttcctggccaagtgccggcccatcgcggtgcgcagcggagacgccttccacgagatccggccgcgcgccgaggtggccaacctcagcgcgcacagcgccagccccatccaggatgcggtcctgaagcgcctgtcgctgctggaggacatcgtgtaccggcagctgaatggcttatccaaatcccttgggctcattgaaggttatggtgggcggggtaaagggggccttccggctactctttccccggctgaagaagaaaaggctaagggaccccatgagaagtatggctacaattcatacctcagtgaaaaaatttcactggaccgttccattccggattatcgtcccaccaagtgtaaggagctcaagtactccaaggacctgccccagatatccatcatattcatcttcgtgaacgaggccctgtcggtgatcctgcggtccgtgcacagtgccgtcaatcacacgcccacacacctgctgaaggaaatcattctggtggatgacaacagcgacgaagaggagctgaaggtccccctagaggagtatgtccacaaacgctaccccgggctggtgaaggtggtaagaaatcagaagagggaaggcctgatccgcgctcgcattgagggctggaaggtggctaccgggcaggtcactggcttctttgatgcccacgtggaattcaccgctggctgggctgagccggttctatcccgcatccaggaaaaccggaagcgtgtgatcctcccctccattgacaacatcaaacaggacaactttgaggtgcagcggtacgagaactcggcccacgggtacagctgggagctgtggtgcatgtacatcagccccccaaaagactggtgggacgccggagacccttctctccccatcaggaccccagccatgataggctgctcgttcgtggtcaacaggaagttcttcggtgaaattggtcttctggatcctggcatggatgtatacggaggagaaaatattgaactgggaatcaaggtatggctctgtgggggcagcatggaggtccttccttgctcacgggtggcccacattgagcggaagaagaagccatataatagcaacattggcttctacaccaagaggaatgctcttcgcgttgctgaggtctggatggacgattacaagtctcatgtgtacatagcgtggaacctgccgctggagaatccgggaattgacatcggtgatgtctccgaaagaagagcattaaggaaaagtttaaagtgtaagaatttccagtggtacctggaccatgtttacccagaaatgagaagatacaataataccgttgcttacggggagcttcgcaacaacaaggcaaaagacgtctgcttggaccaggggccgctggagaaccacacagcaatattgtatccgtgccatggctggggaccacagcttgcccgctacaccaaggaaggcttcctgcacttgggtgccctggggaccaccacactcctccccgacacccgctgcctggtggacaactccaagagtcggctgccccagctcctggactgcgacaaggtcaagagcagcctgtacaagcgctggaacttcatccagaatggagccatcatgaacaagggcacgggacgctgcctggaggtggagaaccggggcctggctggcatcgacctcatcctccgcagctgcacaggtcagaggtggaccattaagaactccatcaagtag
Sequence Length
1797
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
67,751 Da
NCBI Official Full Name
Homo sapiens Williams-Beuren syndrome chromosome region 17, mRNA
NCBI Official Synonym Full Names
Williams-Beuren syndrome chromosome region 17
NCBI Official Symbol
WBSCR17
NCBI Official Synonym Symbols
GALNT16; GALNT20; GALNTL3; GALNACT17; GalNAc-T5L
NCBI Protein Information
putative polypeptide N-acetylgalactosaminyltransferase-like protein 3
UniProt Protein Name
Putative polypeptide N-acetylgalactosaminyltransferase-like protein 3
UniProt Gene Name
WBSCR17
UniProt Synonym Gene Names
GALNTL3; GalNAc-T-like protein 3; pp-GaNTase-like protein 3
UniProt Entry Name
GLTL3_HUMAN
NCBI Description
This gene encodes an N-acetylgalactosaminyltransferase. This gene is located centromeric to the common deleted region in Williams-Beuren syndrome (WBS), a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. This protein may play a role in membrane trafficking. [provided by RefSeq, Jan 2013]
Uniprot Description
WBSCR17: May catalyze the initial reaction in O-linked oligosaccharide biosynthesis, the transfer of an N-acetyl-D- galactosamine residue to a serine or threonine residue on the protein receptor. WBSCR17 is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region. Belongs to the glycosyltransferase 2 family. GalNAc-T subfamily.
Protein type: EC 2.4.1.41; Transferase; Membrane protein, integral; Glycan Metabolism - O-glycan biosynthesis
Chromosomal Location of Human Ortholog: 7q11.23
Research Articles on WBSCR17
Similar Products
Product Notes
The WBSCR17 wbscr17 (Catalog #AAA1276010) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcac tgagaagagt caaagtgctg ttggtgttga acttgatcgc ggtagccggc ttcgtgctct tcctggccaa gtgccggccc atcgcggtgc gcagcggaga cgccttccac gagatccggc cgcgcgccga ggtggccaac ctcagcgcgc acagcgccag ccccatccag gatgcggtcc tgaagcgcct gtcgctgctg gaggacatcg tgtaccggca gctgaatggc ttatccaaat cccttgggct cattgaaggt tatggtgggc ggggtaaagg gggccttccg gctactcttt ccccggctga agaagaaaag gctaagggac cccatgagaa gtatggctac aattcatacc tcagtgaaaa aatttcactg gaccgttcca ttccggatta tcgtcccacc aagtgtaagg agctcaagta ctccaaggac ctgccccaga tatccatcat attcatcttc gtgaacgagg ccctgtcggt gatcctgcgg tccgtgcaca gtgccgtcaa tcacacgccc acacacctgc tgaaggaaat cattctggtg gatgacaaca gcgacgaaga ggagctgaag gtccccctag aggagtatgt ccacaaacgc taccccgggc tggtgaaggt ggtaagaaat cagaagaggg aaggcctgat ccgcgctcgc attgagggct ggaaggtggc taccgggcag gtcactggct tctttgatgc ccacgtggaa ttcaccgctg gctgggctga gccggttcta tcccgcatcc aggaaaaccg gaagcgtgtg atcctcccct ccattgacaa catcaaacag gacaactttg aggtgcagcg gtacgagaac tcggcccacg ggtacagctg ggagctgtgg tgcatgtaca tcagcccccc aaaagactgg tgggacgccg gagacccttc tctccccatc aggaccccag ccatgatagg ctgctcgttc gtggtcaaca ggaagttctt cggtgaaatt ggtcttctgg atcctggcat ggatgtatac ggaggagaaa atattgaact gggaatcaag gtatggctct gtgggggcag catggaggtc cttccttgct cacgggtggc ccacattgag cggaagaaga agccatataa tagcaacatt ggcttctaca ccaagaggaa tgctcttcgc gttgctgagg tctggatgga cgattacaag tctcatgtgt acatagcgtg gaacctgccg ctggagaatc cgggaattga catcggtgat gtctccgaaa gaagagcatt aaggaaaagt ttaaagtgta agaatttcca gtggtacctg gaccatgttt acccagaaat gagaagatac aataataccg ttgcttacgg ggagcttcgc aacaacaagg caaaagacgt ctgcttggac caggggccgc tggagaacca cacagcaata ttgtatccgt gccatggctg gggaccacag cttgcccgct acaccaagga aggcttcctg cacttgggtg ccctggggac caccacactc ctccccgaca cccgctgcct ggtggacaac tccaagagtc ggctgcccca gctcctggac tgcgacaagg tcaagagcag cctgtacaag cgctggaact tcatccagaa tggagccatc atgaacaagg gcacgggacg ctgcctggag gtggagaacc ggggcctggc tggcatcgac ctcatcctcc gcagctgcac aggtcagagg tggaccatta agaactccat caagtag. It is sometimes possible for the material contained within the vial of "WBSCR17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
