Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BCKDK cdna clone

BCKDK cDNA Clone

Gene Names
BCKDK; BDK; BCKDKD
Synonyms
BCKDK; BCKDK cDNA Clone; BCKDK cdna clone
Ordering
For Research Use Only!
Sequence
atgatcctggcgtcggtgctgaggagcggtcccgggggcgggcttccgctccggcccctcctgggacccgcactcgcgctccgggcccgctcgacgtcggccaccgacacacaccacgtggagatggctcgggagcgctccaagaccgtcacctccttttacaaccagtcggccatcgacgcggcagcggagaagccctcagtccgcctaacgcccaccatgatgctctacgctggccgctctcaggacggcagccaccttctgaaaagtgctcggtacctgcagcaagaacttccagtgaggattgctcaccgcatcaagggcttccgctgccttcctttcatcattggctgcaaccccaccatactgcacgtgcatgagctatatatccgtgccttccagaagctgacagacttccctccgatcaaggaccaggcggacgaggcccagtactgccagctggtgcgacagctgctggatgaccacaaggatgtggtgaccctcttggcagagggcctacgtgagagccggaagcacatagaggatgaaaagctcgtccgctacttcttggacaagacgctgacttcgaggcttggaatccgcatgttggccacgcatcacctggcgctgcatgaggacaagcctgactttgtcggcatcatctgtactcgtctctcaccaaagaagattattgagaagtgggtggactttgccagacgcctgtgtgagcacaagtatggcaatgcgccccgtgtccgcatcaatggccatgtggctgcccggttccccttcatccctatgccactggactacatcctgccggagctgctcaagaatgccatgagagccacaatggagagtcacctagacactccctacaatgtcccagatgtggtcatcaccatcgccaacaatgatgtcgatctgatcatcaggatctcagaccgtggtggaggaatcgctcacaaagatctggaccgggtcatggactaccacttcactactgctgaggccagcacacaggacccccggatcagccccctctttggccatctggacatgcatagtggcgcccagtcaggacccatgcacggctttggcttcgggttgcccacgtcacgggcctacgcggagtacctcggtgggtctctgcagctgcagtccctgcagggcattggcacggacgtctacctgcggctccgccacatcgatggccgggaggaaagcttccggatctga
Sequence Length
1239
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,090 Da
NCBI Official Full Name
Homo sapiens branched chain ketoacid dehydrogenase kinase, mRNA
NCBI Official Synonym Full Names
branched chain ketoacid dehydrogenase kinase
NCBI Official Symbol
BCKDK
NCBI Official Synonym Symbols
BDK; BCKDKD
NCBI Protein Information
[3-methyl-2-oxobutanoate dehydrogenase [lipoamide]] kinase, mitochondrial
UniProt Protein Name
[3-methyl-2-oxobutanoate dehydrogenase [lipoamide]] kinase, mitochondrial
UniProt Gene Name
BCKDK
UniProt Synonym Gene Names
BCKD-kinase; BCKDHKIN
UniProt Entry Name
BCKD_HUMAN

NCBI Description

The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]

Uniprot Description

BCKDK: an atypical protein kinase associated with the mitochondrial matrix. Contains a HATPase_c domain, found in several ATP-binding proteins including protein histidine kinases (PHKs), PHDKs, DNA gyrase B, topoisomerases, heat shock proteins, and DNA mismatch repair proteins. Unlike PHKs, BCK dimerizes through direct interaction of two opposing nucleotide-binding domains. Phosphorylates and inactivates the E1-alpha subunit of the branched-chain ketoacid dehydrogenase (BCKDK), the key regulatory enzyme of the valine, leucine and isoleucine catabolic pathways. Inactivating mutations have been discovered in BCKDK in families with autism, epilepsy, and intellectual disability, a syndrome that may respond to dietary supplementation.

Protein type: EC 2.7.11.4; Kinase, protein; Protein kinase, atypical; Mitochondrial; ATYPICAL group; PDHK family

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: mitochondrial alpha-ketoglutarate dehydrogenase complex; mitochondrial matrix; mitochondrion

Molecular Function: [3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity; ATP binding; kinase activity; protein binding; protein serine/threonine kinase activity

Biological Process: branched chain family amino acid catabolic process; phosphorylation

Disease: Branched-chain Ketoacid Dehydrogenase Kinase Deficiency

Research Articles on BCKDK

Similar Products

Product Notes

The BCKDK bckdk (Catalog #AAA1275594) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcctgg cgtcggtgct gaggagcggt cccgggggcg ggcttccgct ccggcccctc ctgggacccg cactcgcgct ccgggcccgc tcgacgtcgg ccaccgacac acaccacgtg gagatggctc gggagcgctc caagaccgtc acctcctttt acaaccagtc ggccatcgac gcggcagcgg agaagccctc agtccgccta acgcccacca tgatgctcta cgctggccgc tctcaggacg gcagccacct tctgaaaagt gctcggtacc tgcagcaaga acttccagtg aggattgctc accgcatcaa gggcttccgc tgccttcctt tcatcattgg ctgcaacccc accatactgc acgtgcatga gctatatatc cgtgccttcc agaagctgac agacttccct ccgatcaagg accaggcgga cgaggcccag tactgccagc tggtgcgaca gctgctggat gaccacaagg atgtggtgac cctcttggca gagggcctac gtgagagccg gaagcacata gaggatgaaa agctcgtccg ctacttcttg gacaagacgc tgacttcgag gcttggaatc cgcatgttgg ccacgcatca cctggcgctg catgaggaca agcctgactt tgtcggcatc atctgtactc gtctctcacc aaagaagatt attgagaagt gggtggactt tgccagacgc ctgtgtgagc acaagtatgg caatgcgccc cgtgtccgca tcaatggcca tgtggctgcc cggttcccct tcatccctat gccactggac tacatcctgc cggagctgct caagaatgcc atgagagcca caatggagag tcacctagac actccctaca atgtcccaga tgtggtcatc accatcgcca acaatgatgt cgatctgatc atcaggatct cagaccgtgg tggaggaatc gctcacaaag atctggaccg ggtcatggac taccacttca ctactgctga ggccagcaca caggaccccc ggatcagccc cctctttggc catctggaca tgcatagtgg cgcccagtca ggacccatgc acggctttgg cttcgggttg cccacgtcac gggcctacgc ggagtacctc ggtgggtctc tgcagctgca gtccctgcag ggcattggca cggacgtcta cctgcggctc cgccacatcg atggccggga ggaaagcttc cggatctga. It is sometimes possible for the material contained within the vial of "BCKDK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.