Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRMT6 cdna clone

TRMT6 cDNA Clone

Gene Names
TRMT6; GCD10; CGI-09; Gcd10p
Synonyms
TRMT6; TRMT6 cDNA Clone; TRMT6 cdna clone
Ordering
For Research Use Only!
Sequence
atggagggctcaggggagcagccgggcccacaaccacagcatcccggagaccaccgcatccgcgacggcgacttcgtggtgctgaaacgtgaagatgtgtttaaagcagtacaagtccagcggagaaaaaaagtaactttcgaaaaacagtggttctacctggataacgtcattggccatagttatggaactgcatttgaagtgaccagtggaggaagtctacagcccaagaagaagagggaagagcctactgcagagactaaagaagcgggcactgataatcgaaatatagttgatgatgggaaatctcagaaacttactcaagatgacataaaagctttgaaggacaagggcattaaaggagaggaaatagttcagcagttaattgaaaatagtacaacattccgagacaagacagaatttgcccaagataaatatattaaaaagaagaaaaaaaaatatgaagccatcattactgttgtgaagccatccacccgtattctttcaattatgtattatgcaagagaacctggaaaaattaaccacatgagatacgatacactagcccagatgttgacgttgggaaatatccgtgctggcaacaaaatgattgtgatggaaacgtgtgcaggcttggtgctgggtgcaatgatggaacgaatgggaggttttggctccattattcagctataccctggaggaggacctgttcgggcagcaacagcatgttttggatttcccaaatcttttctcagtggtctttatgaattccctctcaacaaagtggacagtcttctacatggaacattttctgccaagatgttatcttcagagccaaaagacagtgctttggttgaagaaagtaatggcacactggaggaaaaacaggcttctgaacaagagaatgaagacagcatggcagaggccccagagagcaaccacccagaagaccaggaaacaatggaaacaatttctcaagatccagaacataaggggcctaaagagagaggaagcaaaaaagattatattcaggaaaaacagaggagacaagaagagcagaggaaaagacatttagaggctgccgctctgctgagtgaaagaaacgcagatggtttaattgtagctagtcgtttccaccccactcccctgctgctgtctttgctggactttgtggccccttcaaggccgtttgtggtctactgtcagtacaaagagcctctgttggaatgctacacaaaactgcgggagaggggaggggtcatcaacctcaggctgtctgaaacctggctcagaaattatcaggttttgccagatcgaagtcatcctaaactgctgatgagtggaggtgggggttatcttctctccggcttcaccgttgccatggacaaccttaaagcagacaccagcctcaaatctaatgcaagcactttagaatcacacgagactgaggagcctgcagctaaaaaacgaaaatgcccagagtctgactcttaa
Sequence Length
1494
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,439 Da
NCBI Official Full Name
Homo sapiens tRNA methyltransferase 6 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
tRNA methyltransferase 6
NCBI Official Symbol
TRMT6
NCBI Official Synonym Symbols
GCD10; CGI-09; Gcd10p
NCBI Protein Information
tRNA (adenine(58)-N(1))-methyltransferase non-catalytic subunit TRM6
UniProt Protein Name
tRNA (adenine(58)-N(1))-methyltransferase non-catalytic subunit TRM6
UniProt Gene Name
TRMT6
UniProt Synonym Gene Names
KIAA1153; TRM6; tRNA(m1A58)MTase subunit TRM6
UniProt Entry Name
TRM6_HUMAN

NCBI Description

This gene encodes a member of the tRNA methyltransferase 6 protein family. A similar protein in yeast is part of a two component methyltransferase, which is involved in the posttranslational modification that produces the modified nucleoside 1-methyladenosine in tRNAs. Modified 1-methyladenosine influences initiator methionine stability and may be involved in the replication of human immunodeficiency virus type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Uniprot Description

CGI-09: Substrate-binding subunit of tRNA (adenine-N(1)-)- methyltransferase, which catalyzes the formation of N(1)- methyladenine at position 58 (m1A58) in initiator methionyl-tRNA. Belongs to the TRM6/GCD10 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Translation

Chromosomal Location of Human Ortholog: 20p12.3

Cellular Component: nucleoplasm

Biological Process: tRNA modification

Similar Products

Product Notes

The TRMT6 trmt6 (Catalog #AAA1275359) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagggct caggggagca gccgggccca caaccacagc atcccggaga ccaccgcatc cgcgacggcg acttcgtggt gctgaaacgt gaagatgtgt ttaaagcagt acaagtccag cggagaaaaa aagtaacttt cgaaaaacag tggttctacc tggataacgt cattggccat agttatggaa ctgcatttga agtgaccagt ggaggaagtc tacagcccaa gaagaagagg gaagagccta ctgcagagac taaagaagcg ggcactgata atcgaaatat agttgatgat gggaaatctc agaaacttac tcaagatgac ataaaagctt tgaaggacaa gggcattaaa ggagaggaaa tagttcagca gttaattgaa aatagtacaa cattccgaga caagacagaa tttgcccaag ataaatatat taaaaagaag aaaaaaaaat atgaagccat cattactgtt gtgaagccat ccacccgtat tctttcaatt atgtattatg caagagaacc tggaaaaatt aaccacatga gatacgatac actagcccag atgttgacgt tgggaaatat ccgtgctggc aacaaaatga ttgtgatgga aacgtgtgca ggcttggtgc tgggtgcaat gatggaacga atgggaggtt ttggctccat tattcagcta taccctggag gaggacctgt tcgggcagca acagcatgtt ttggatttcc caaatctttt ctcagtggtc tttatgaatt ccctctcaac aaagtggaca gtcttctaca tggaacattt tctgccaaga tgttatcttc agagccaaaa gacagtgctt tggttgaaga aagtaatggc acactggagg aaaaacaggc ttctgaacaa gagaatgaag acagcatggc agaggcccca gagagcaacc acccagaaga ccaggaaaca atggaaacaa tttctcaaga tccagaacat aaggggccta aagagagagg aagcaaaaaa gattatattc aggaaaaaca gaggagacaa gaagagcaga ggaaaagaca tttagaggct gccgctctgc tgagtgaaag aaacgcagat ggtttaattg tagctagtcg tttccacccc actcccctgc tgctgtcttt gctggacttt gtggcccctt caaggccgtt tgtggtctac tgtcagtaca aagagcctct gttggaatgc tacacaaaac tgcgggagag gggaggggtc atcaacctca ggctgtctga aacctggctc agaaattatc aggttttgcc agatcgaagt catcctaaac tgctgatgag tggaggtggg ggttatcttc tctccggctt caccgttgcc atggacaacc ttaaagcaga caccagcctc aaatctaatg caagcacttt agaatcacac gagactgagg agcctgcagc taaaaaacga aaatgcccag agtctgactc ttaa. It is sometimes possible for the material contained within the vial of "TRMT6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.