ZC3H7A cdna clone
ZC3H7A cDNA Clone
Gene Names
ZC3H7A; ZC3H7; HSPC055; ZC3HDC7
Synonyms
ZC3H7A; ZC3H7A cDNA Clone; ZC3H7A cdna clone
Sequence
atgaaggagaatgggatacaagatatggagcaattttacgaactatggctcaagagtcaaaaaaatgaaaaaagtgaagacatagccagtcagtcaaacaaggaaaatggaaaacaaattcacatgccaacagattatgctgaagttacagtggactttcactgctggatgtgtgggaaaaactgcaacagtgagaagcagtggcagggccacatctcctccgagaagcacaaagagaaggttttccacaccgaggacgaccagtactgctggcagcaccgcttcccaacaggctatttcagtatttgtgataggtatatgaatggcacctgcccagaaggaaacagctgtaaatttgcacatggaaatgccgaacttcatgaatgggaagaaagaagagatgccctaaagatgaagctcaacaaagcacgaaaagatcacttaattggcccaaatgataatgactttggaaaatatagttttttgtttaaagatttaaactaa
Sequence Length
504
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,811 Da
NCBI Official Full Name
Homo sapiens zinc finger CCCH-type containing 7A, mRNA
NCBI Official Synonym Full Names
zinc finger CCCH-type containing 7A
NCBI Official Symbol
ZC3H7A
NCBI Official Synonym Symbols
ZC3H7; HSPC055; ZC3HDC7
NCBI Protein Information
zinc finger CCCH domain-containing protein 7A
UniProt Protein Name
Zinc finger CCCH domain-containing protein 7A
Protein Family
UniProt Gene Name
ZC3H7A
UniProt Synonym Gene Names
ZC3H7; ZC3HDC7
UniProt Entry Name
Z3H7A_HUMAN
Uniprot Description
ZC3H7A: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: RNA-binding; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 16p13-p12
Similar Products
Product Notes
The ZC3H7A zc3h7a (Catalog #AAA1274905) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggaga atgggataca agatatggag caattttacg aactatggct caagagtcaa aaaaatgaaa aaagtgaaga catagccagt cagtcaaaca aggaaaatgg aaaacaaatt cacatgccaa cagattatgc tgaagttaca gtggactttc actgctggat gtgtgggaaa aactgcaaca gtgagaagca gtggcagggc cacatctcct ccgagaagca caaagagaag gttttccaca ccgaggacga ccagtactgc tggcagcacc gcttcccaac aggctatttc agtatttgtg ataggtatat gaatggcacc tgcccagaag gaaacagctg taaatttgca catggaaatg ccgaacttca tgaatgggaa gaaagaagag atgccctaaa gatgaagctc aacaaagcac gaaaagatca cttaattggc ccaaatgata atgactttgg aaaatatagt tttttgttta aagatttaaa ctaa. It is sometimes possible for the material contained within the vial of "ZC3H7A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
