ADCY4 cdna clone
ADCY4 cDNA Clone
Gene Names
ADCY4; AC4
Synonyms
ADCY4; ADCY4 cDNA Clone; ADCY4 cdna clone
Sequence
atggcccgcctcttcagcccccggccgccccccagcgaagacctcttctacgagacctactacagcctgagccagcagtacccgctgctgctgctgctgctggggatcgtgctctgtgcgctcgcggcgctgctcgcagtggcctgggccagcggcagggagctgacctcagacccgagcttcctgaccactgtgctgtgcgcgctgggcggcttctcgctgctgctgggcctcgcttcccgggagcagcgactgcagcgctggacgcgtcccctgtccggcttggtatgggtcgcgctgctagcgctaggccacgccttcctgttcaccgggggcgtggtgagcgcctgggaccaggtgtcctattttctcttcgtcatcttcacggcgtatgccatgctgcccttgggcatgcgggacgccgccgtcgcgggcctcgcctcctcactctcgcatctgctggtcctcgggctgtatcttgggccacagccggactcacggcctgcactgctgccgcagttggcagcaaacgcagtgctgttcctgtgcgggaacgtggcaggagtgtaccacaaggcgctgatggagcgcgccctgcgggccacgttccgggaggcactcagctccctgcactcacgccggcggctggacaccgagaagaagcaccaggaacaccttctcttgtccatccttcctgcctacctggcccgagagatgaaggcagagatcatggcacggctgcaggcaggacaggggtcacggccagagagcactaacaatttccacagcctctatgtcaagaggcaccagggagtcagcgtgctgtatgctgacatcgtgggcttcacgcggctggccagcgagtgttcccctaaggagctggtgctcatgctcaatgagctctttggcaagttcgaccagattgccaaggagcatgaatgcatgcggatcaagatcctgggggactgttactactgtgtctctgggctgccactctcactgccagaccatgccatcaactgcgtgcgcatgggcctggacatgtgccgggccatcaggaaactgcgggcagccactggcgtggacatcaacatgcgtgtgggcgtgcactcaggcagcgtactgtgtggagtcatcgggctgcagaagtggcagtacgacgtttggtcacatgatgtcacactggctaaccacatggaggcaggcggtgtaccagggcgagtgcacatcacaggggctaccctggccctgctggcaggggcttatgctgtggaggacgcaggcatggagcatcgggacccctaccttcgggagctaggggagcctacctatctggtcatcgatccacgggcagaggaggaggatgagaagggcactgcaggaggcttgctgtcctcgcttgagggcctcaagatgcgtccatcactgctgatgacccgttacctggagtcctggggcgcagccaagccttttgcccacctgagccacggagacagccctgtgtccacctccacccctctcccggagaagaccctggcttccttcagcacccagtggagcctggatcggagccgtaccccccggggactagatgatgaactggacaccggggatgccaagttcttccaggtcattgagcagctcaactcgcagaaacagtggaagcagtcgaaggacttcaacccactgacactgtacttcagagagaaggagatggagaaagagtaccgactctctgcaatccccgccttcaaatactatgaagcctgcaccttcctggtttttctctccaacttcatcatccagatgctagtgacaaacaggcccccagctctggccatcacgtatagcatcaccttcctcctcttcctcctcatcctttttgtctgcttctcagaggacctgatgaggtgtgtcctgaaaggccccaagatgctgcactggctgcctgcactgtctggcctggtggccacacgaccaggactgagaatagccttgggcaccgccaccatcctccttgtctttgccatggccattaccagcctgttcttcttcccaacatcatcagactgccctttccaagctcccaatgtgtcctccatgatttccaacctctcctgggagctccctgggtctctgcctctcatcagtgtcccatactccatgcactgctgcacgctgggcttcctctcctgctccctctttctgcacatgagcttcgagctgaagctgctgctgctcctgctgtggctggcggcatcctgctccctcttcctgcactcccatgcctggctgtcggaatgcctcatcgtccgcctctatctgggccccttggactccaggcccggagtgctgaaggagcccaaactgatgggtgctatctccttcttcatcttcttcttcaccctccttgtcctggctcgccagaatgagtactactgccgcctggacttcctgtggaagaagaagctgaggcaggagagggaggagacagagacgatggagaacctgactcggctgctcttggagaacgtgctccctgcacacgtggccccccagttcattggccagaaccggcgcaacgaggatctctaccaccagtcctatgaatgcgtttgtgtcctcttcgcctcagtcccagacttcaaggagttctactctgaatccaacatcaatcatgagggcctagagtgtctgaggctgctcaatgagataattgctgattttgatgagctgctctccaagcccaagttcagtggggtggagaagatcaagaccatcggcagcacctacatggcagccacaggcttaaatgccacctctggacaggatgcacaacaggatgctgaacggagctgcagccaccttggcactatggtggaatttgccgtggccctggggtctaagctggacgtcatcaacaagcattcattcaacaacttccgcctgcgagtggggttgaaccatggacccgtagtagctggagttattggggcccagaagccgcaatatgacatttggggcaacacagtgaacgtggccagccgcatggagagtacaggagtccttggcaaaatccaagtgactgaggagacagcatgggccctacagtccctgggctacacctgctacagccggggtgtcatcaaggtgaaaggcaaagggcagctctgcacctacttcctgaacacagacttgacacgaactggacctccttcagctaccctaggctga
Sequence Length
3234
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
46,245 Da
NCBI Official Full Name
Homo sapiens adenylate cyclase 4, mRNA
NCBI Official Synonym Full Names
adenylate cyclase 4
NCBI Official Symbol
ADCY4
NCBI Official Synonym Symbols
AC4
NCBI Protein Information
adenylate cyclase type 4
UniProt Protein Name
Adenylate cyclase type 4
Protein Family
UniProt Gene Name
ADCY4
UniProt Entry Name
ADCY4_HUMAN
NCBI Description
This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
Uniprot Description
ADCY4: This is a membrane-bound, calmodulin-insensitive adenylyl cyclase. Belongs to the adenylyl cyclase class-4/guanylyl cyclase family.
Protein type: Transporter; Nucleotide Metabolism - purine; Membrane protein, integral; Transporter, aquaporin family; Lyase; EC 4.6.1.1; Membrane protein, multi-pass; Adenylyl cyclase
Chromosomal Location of Human Ortholog: 14q12
Cellular Component: cytoplasm; membrane; plasma membrane
Molecular Function: adenylate cyclase activity; protein binding
Biological Process: activation of protein kinase A; adenylate cyclase activation; cAMP biosynthetic process; cAMP-mediated signaling; G-protein signaling, adenylate cyclase activating pathway; G-protein signaling, adenylate cyclase inhibiting pathway; G-protein signaling, coupled to cAMP nucleotide second messenger; renal water homeostasis
Research Articles on ADCY4
Similar Products
Product Notes
The ADCY4 adcy4 (Catalog #AAA1274584) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccgcc tcttcagccc ccggccgccc cccagcgaag acctcttcta cgagacctac tacagcctga gccagcagta cccgctgctg ctgctgctgc tggggatcgt gctctgtgcg ctcgcggcgc tgctcgcagt ggcctgggcc agcggcaggg agctgacctc agacccgagc ttcctgacca ctgtgctgtg cgcgctgggc ggcttctcgc tgctgctggg cctcgcttcc cgggagcagc gactgcagcg ctggacgcgt cccctgtccg gcttggtatg ggtcgcgctg ctagcgctag gccacgcctt cctgttcacc gggggcgtgg tgagcgcctg ggaccaggtg tcctattttc tcttcgtcat cttcacggcg tatgccatgc tgcccttggg catgcgggac gccgccgtcg cgggcctcgc ctcctcactc tcgcatctgc tggtcctcgg gctgtatctt gggccacagc cggactcacg gcctgcactg ctgccgcagt tggcagcaaa cgcagtgctg ttcctgtgcg ggaacgtggc aggagtgtac cacaaggcgc tgatggagcg cgccctgcgg gccacgttcc gggaggcact cagctccctg cactcacgcc ggcggctgga caccgagaag aagcaccagg aacaccttct cttgtccatc cttcctgcct acctggcccg agagatgaag gcagagatca tggcacggct gcaggcagga caggggtcac ggccagagag cactaacaat ttccacagcc tctatgtcaa gaggcaccag ggagtcagcg tgctgtatgc tgacatcgtg ggcttcacgc ggctggccag cgagtgttcc cctaaggagc tggtgctcat gctcaatgag ctctttggca agttcgacca gattgccaag gagcatgaat gcatgcggat caagatcctg ggggactgtt actactgtgt ctctgggctg ccactctcac tgccagacca tgccatcaac tgcgtgcgca tgggcctgga catgtgccgg gccatcagga aactgcgggc agccactggc gtggacatca acatgcgtgt gggcgtgcac tcaggcagcg tactgtgtgg agtcatcggg ctgcagaagt ggcagtacga cgtttggtca catgatgtca cactggctaa ccacatggag gcaggcggtg taccagggcg agtgcacatc acaggggcta ccctggccct gctggcaggg gcttatgctg tggaggacgc aggcatggag catcgggacc cctaccttcg ggagctaggg gagcctacct atctggtcat cgatccacgg gcagaggagg aggatgagaa gggcactgca ggaggcttgc tgtcctcgct tgagggcctc aagatgcgtc catcactgct gatgacccgt tacctggagt cctggggcgc agccaagcct tttgcccacc tgagccacgg agacagccct gtgtccacct ccacccctct cccggagaag accctggctt ccttcagcac ccagtggagc ctggatcgga gccgtacccc ccggggacta gatgatgaac tggacaccgg ggatgccaag ttcttccagg tcattgagca gctcaactcg cagaaacagt ggaagcagtc gaaggacttc aacccactga cactgtactt cagagagaag gagatggaga aagagtaccg actctctgca atccccgcct tcaaatacta tgaagcctgc accttcctgg tttttctctc caacttcatc atccagatgc tagtgacaaa caggccccca gctctggcca tcacgtatag catcaccttc ctcctcttcc tcctcatcct ttttgtctgc ttctcagagg acctgatgag gtgtgtcctg aaaggcccca agatgctgca ctggctgcct gcactgtctg gcctggtggc cacacgacca ggactgagaa tagccttggg caccgccacc atcctccttg tctttgccat ggccattacc agcctgttct tcttcccaac atcatcagac tgccctttcc aagctcccaa tgtgtcctcc atgatttcca acctctcctg ggagctccct gggtctctgc ctctcatcag tgtcccatac tccatgcact gctgcacgct gggcttcctc tcctgctccc tctttctgca catgagcttc gagctgaagc tgctgctgct cctgctgtgg ctggcggcat cctgctccct cttcctgcac tcccatgcct ggctgtcgga atgcctcatc gtccgcctct atctgggccc cttggactcc aggcccggag tgctgaagga gcccaaactg atgggtgcta tctccttctt catcttcttc ttcaccctcc ttgtcctggc tcgccagaat gagtactact gccgcctgga cttcctgtgg aagaagaagc tgaggcagga gagggaggag acagagacga tggagaacct gactcggctg ctcttggaga acgtgctccc tgcacacgtg gccccccagt tcattggcca gaaccggcgc aacgaggatc tctaccacca gtcctatgaa tgcgtttgtg tcctcttcgc ctcagtccca gacttcaagg agttctactc tgaatccaac atcaatcatg agggcctaga gtgtctgagg ctgctcaatg agataattgc tgattttgat gagctgctct ccaagcccaa gttcagtggg gtggagaaga tcaagaccat cggcagcacc tacatggcag ccacaggctt aaatgccacc tctggacagg atgcacaaca ggatgctgaa cggagctgca gccaccttgg cactatggtg gaatttgccg tggccctggg gtctaagctg gacgtcatca acaagcattc attcaacaac ttccgcctgc gagtggggtt gaaccatgga cccgtagtag ctggagttat tggggcccag aagccgcaat atgacatttg gggcaacaca gtgaacgtgg ccagccgcat ggagagtaca ggagtccttg gcaaaatcca agtgactgag gagacagcat gggccctaca gtccctgggc tacacctgct acagccgggg tgtcatcaag gtgaaaggca aagggcagct ctgcacctac ttcctgaaca cagacttgac acgaactgga cctccttcag ctaccctagg ctga. It is sometimes possible for the material contained within the vial of "ADCY4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
