Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFNA4 cdna clone

IFNA4 cDNA Clone

Gene Names
IFNA4; INFA4; IFN-alpha4a
Synonyms
IFNA4; IFNA4 cDNA Clone; IFNA4 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctgtccttttctttactgatggccgtgctggtgctcagctacaaatccatctgttctctgggctgtgatctgcctcagacccacagcctgggtaataggagggccttgatactcctggcacaaatgggaagaatctctcatttctcctgcctgaaggacagacatgatttcggattccccgaggaggagtttgatggccaccagttccagaaggctcaagccatctctgtcctccatgagatgatccagcagaccttcaatctcttcagcacagaggactcatctgctgcttgggaacagagcctcctagaaaaattttccactgaactttaccagcaactgaatgacctggaagcatgtgtgatacaggaggttggggtggaagagactcccctgatgaatgaggactccatcctggctgtgaggaaatacttccaaagaatcactctttatctaacagagaagaaatacagcccttgtgcctgggaggttgtcagagcagaaatcatgagatccctctcgttttcaacaaacttgcaaaaaagattaaggaggaaggattga
Sequence Length
570
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,808 Da
NCBI Official Full Name
Homo sapiens interferon, alpha 4, mRNA
NCBI Official Synonym Full Names
interferon alpha 4
NCBI Official Symbol
IFNA4
NCBI Official Synonym Symbols
INFA4; IFN-alpha4a
NCBI Protein Information
interferon alpha-4
UniProt Protein Name
Interferon alpha-4
UniProt Gene Name
IFNA4
UniProt Synonym Gene Names
IFN-alpha-4
UniProt Entry Name
IFNA4_HUMAN

Uniprot Description

IFNA4: Produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. Belongs to the alpha/beta interferon family.

Protein type: Cytokine; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 9p22

Cellular Component: extracellular region; extracellular space

Molecular Function: cytokine activity; interferon-alpha/beta receptor binding; protein binding

Biological Process: adaptive immune response; B cell differentiation; B cell proliferation; blood coagulation; cytokine and chemokine mediated signaling pathway; humoral immune response; innate immune response; natural killer cell activation during immune response; positive regulation of peptidyl-serine phosphorylation of STAT protein; response to exogenous dsRNA; response to virus; T cell activation during immune response

Research Articles on IFNA4

Similar Products

Product Notes

The IFNA4 ifna4 (Catalog #AAA1274528) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctgt ccttttcttt actgatggcc gtgctggtgc tcagctacaa atccatctgt tctctgggct gtgatctgcc tcagacccac agcctgggta ataggagggc cttgatactc ctggcacaaa tgggaagaat ctctcatttc tcctgcctga aggacagaca tgatttcgga ttccccgagg aggagtttga tggccaccag ttccagaagg ctcaagccat ctctgtcctc catgagatga tccagcagac cttcaatctc ttcagcacag aggactcatc tgctgcttgg gaacagagcc tcctagaaaa attttccact gaactttacc agcaactgaa tgacctggaa gcatgtgtga tacaggaggt tggggtggaa gagactcccc tgatgaatga ggactccatc ctggctgtga ggaaatactt ccaaagaatc actctttatc taacagagaa gaaatacagc ccttgtgcct gggaggttgt cagagcagaa atcatgagat ccctctcgtt ttcaacaaac ttgcaaaaaa gattaaggag gaaggattga. It is sometimes possible for the material contained within the vial of "IFNA4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.