Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FGD6 cdna clone

FGD6 cDNA Clone

Gene Names
FGD6; ZFYVE24
Synonyms
FGD6; FGD6 cDNA Clone; FGD6 cdna clone
Ordering
For Research Use Only!
Sequence
atgagccctcgctgtgctaatctggccctcaagcactacctgctcaagccggttcagaggatcccccagtacaggctgttgctgacagattatttgaagaatctcatagaagatgctggagattacagagacactcaagatgcccttgctgttgttgtagaggtagccaaccacgccaatgacaccatgaagcaaggagacaactttcagaaacttatgcaaattcagtacagcttaaatggacaccatgaaattgtgcagcctggtcgggtttttctcaaagaaggaattctgatgaagctgtctcggaaagtgatgcaacctcgaatgtttttcctgtttaatgatgccctgctgtatacaacaccagtgcagtctgggatgtataaactgaacaacatgctctcactggctggaatgaaggtcagaaaacctacccaagaagcctatcagaatgaattaaagattgaaagtgtagaacgttccttcattctctcagccagttctgccacagaaagggatgaatggctagaagcgatttccagggcaatagaagagtatgccaagaaaagaatcaccttctgtcctagtaggagtcttgatgaggcagactcagaaaataaagaagaagttagtcctcttggatcgaaggctcccatctggattcctgataccagagccacaatgtgtatgatctgcacaagcgaattcactctcacctggagacgacaccactgccgggcctgtggaaagattgtatgccaagcttgttcgtctaataagtatggcttagattacctgaaaaatcaaccagcaagagtatgtgaacattgtttccaagaactgcagaaattagatcaccagcactcccctaggattggatctcctggaaatcacaaatctccttcaagtgccttatcatcagtcttacatagcattccatcagggaggaaacagaaaaaaatcccagctgctctcaaagaagtatcagcaaacacagaggattcttctatgagtggctacttgtacagatcaaagggcaataaaaaaccctggaaacacttttggtttgtcataaaaaataaagtactatatacatatgctgcaagtgaggtaagatctgaaatctaa
Sequence Length
1131
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
154,465 Da
NCBI Official Full Name
Homo sapiens FYVE, RhoGEF and PH domain containing 6, mRNA
NCBI Official Synonym Full Names
FYVE, RhoGEF and PH domain containing 6
NCBI Official Symbol
FGD6
NCBI Official Synonym Symbols
ZFYVE24
NCBI Protein Information
FYVE, RhoGEF and PH domain-containing protein 6
UniProt Protein Name
FYVE, RhoGEF and PH domain-containing protein 6
UniProt Gene Name
FGD6
UniProt Synonym Gene Names
KIAA1362; ZFYVE24
UniProt Entry Name
FGD6_HUMAN

Uniprot Description

FGD6: May activate CDC42, a member of the Ras-like family of Rho- and Rac proteins, by exchanging bound GDP for free GTP. May play a role in regulating the actin cytoskeleton and cell shape. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs; GEFs, Rac/Rho

Chromosomal Location of Human Ortholog: 12q22

Cellular Component: cytoplasm; Golgi apparatus; lamellipodium; ruffle

Molecular Function: guanyl-nucleotide exchange factor activity; small GTPase binding

Biological Process: actin cytoskeleton organization and biogenesis; cytoskeleton organization and biogenesis; filopodium formation; regulation of cell shape; regulation of GTPase activity

Similar Products

Product Notes

The FGD6 fgd6 (Catalog #AAA1274277) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccctc gctgtgctaa tctggccctc aagcactacc tgctcaagcc ggttcagagg atcccccagt acaggctgtt gctgacagat tatttgaaga atctcataga agatgctgga gattacagag acactcaaga tgcccttgct gttgttgtag aggtagccaa ccacgccaat gacaccatga agcaaggaga caactttcag aaacttatgc aaattcagta cagcttaaat ggacaccatg aaattgtgca gcctggtcgg gtttttctca aagaaggaat tctgatgaag ctgtctcgga aagtgatgca acctcgaatg tttttcctgt ttaatgatgc cctgctgtat acaacaccag tgcagtctgg gatgtataaa ctgaacaaca tgctctcact ggctggaatg aaggtcagaa aacctaccca agaagcctat cagaatgaat taaagattga aagtgtagaa cgttccttca ttctctcagc cagttctgcc acagaaaggg atgaatggct agaagcgatt tccagggcaa tagaagagta tgccaagaaa agaatcacct tctgtcctag taggagtctt gatgaggcag actcagaaaa taaagaagaa gttagtcctc ttggatcgaa ggctcccatc tggattcctg ataccagagc cacaatgtgt atgatctgca caagcgaatt cactctcacc tggagacgac accactgccg ggcctgtgga aagattgtat gccaagcttg ttcgtctaat aagtatggct tagattacct gaaaaatcaa ccagcaagag tatgtgaaca ttgtttccaa gaactgcaga aattagatca ccagcactcc cctaggattg gatctcctgg aaatcacaaa tctccttcaa gtgccttatc atcagtctta catagcattc catcagggag gaaacagaaa aaaatcccag ctgctctcaa agaagtatca gcaaacacag aggattcttc tatgagtggc tacttgtaca gatcaaaggg caataaaaaa ccctggaaac acttttggtt tgtcataaaa aataaagtac tatatacata tgctgcaagt gaggtaagat ctgaaatcta a. It is sometimes possible for the material contained within the vial of "FGD6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.