ZBED5 cdna clone
ZBED5 cDNA Clone
Gene Names
ZBED5; Buster1
Synonyms
ZBED5; ZBED5 cDNA Clone; ZBED5 cdna clone
Sequence
atgattgctcctcttctttgtatcctgtcttataatttcaacacatttgcgatactcaatgtctattctaaattaaccatgttttgtaccacaaactcattgcccatggatctgttgctgaaacaaggaagtcttaaacaagaagtggaatctttctgttatcagattgtgtctgaatcaaatgatcagaaggttggaatattacaaagtgaagataagcagttgcaaccttcagtttctaaaaaatcagaaggtgagctttccagggtcaaatttatatccaattccaacaaaataacatttagtaaaaaaccaaaaagaagaaaatatgatgaaagttatttgtcttttggatttacttacttcggaaatagagatgcacctcatgctcagtgtgtattatgtaagaaaattttatcaaatagctctttagcccctagtaagcttcgaagacatttggaaactaaacatgctgcatataaagacaaagacataagctttttcaagcaacatctcgattcacctgaaaataataaacccccaacacctaaaattgtgaatacagataatgaaagtgctacagaagcatcatacaatgtaagttaccatatagcgctgagtggagaggctcatactattggagaattgcttatcaaaccttgtgcaaaagatgtagtgatgcggatgtttgatgaacaatatagtaaaaaaatagatgcagtacagctatcaaacagtactgttgcacgtcgaattaaggatctagctgctgacattgaagaagagcttgtttgtagactgaaaatttgcgatgggttttcactgcaactagatgaatcagctgatgtttcaggacttgctgtgctgcttgtgtttgttcgttataggtttaataagtctattgaggaagacctactcctgtgtgaatctttgcaaagtaatgctaccggtgaagaaatattcaactgtatcaacagttttatgcagaaacatgaaattgaatgggaaaaatgtgttgatgtttgtagtgatgcttctagggcagtggatgggaaaattgccgaagctgtcaccttaataaaatatgtggctcccgaaagcaccagtagtcactgcctattatacagacatgcactggcagttaaaataatgcctacatctctaaaaaatgtgctagaccaggcagtacaaatcatcaattatattaaagctcgaccacatcaatccagactattaaaaattttatgtgaggaaatgggtgctcagcacacagcacttcttctaaatacagaggtgaggtggctttctcgaggtaaagttcttgtaagactttttgaacttcgtcgtgaacttttggttttcatggattctgcttttcgactatctgattgtttaacaaattcatcttggctgctaagacttgcatatcttgcagatatttttactaaattaaatgaagttaatttgtcaatgcaaggaaaaatgtga
Sequence Length
1488
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
78,911 Da
NCBI Official Full Name
Homo sapiens zinc finger, BED-type containing 5, mRNA
NCBI Official Synonym Full Names
zinc finger BED-type containing 5
NCBI Official Symbol
ZBED5
NCBI Official Synonym Symbols
Buster1
NCBI Protein Information
zinc finger BED domain-containing protein 5
UniProt Protein Name
Zinc finger BED domain-containing protein 5
Protein Family
UniProt Gene Name
ZBED5
UniProt Synonym Gene Names
Buster1
UniProt Entry Name
ZBED5_HUMAN
NCBI Description
This gene is unusual in that its coding sequence is mostly derived from Charlie-like DNA transposon; however, it does not appear to be an active DNA transposon as it is not flanked by terminal inverted repeats. The encoded protein is conserved among the mammalian Laurasiatheria branch. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2009]
Uniprot Description
ZBED5:
Chromosomal Location of Human Ortholog: 11p15.3
Cellular Component: cytoplasm; nucleoplasm
Molecular Function: DNA binding
Research Articles on ZBED5
Similar Products
Product Notes
The ZBED5 zbed5 (Catalog #AAA1273820) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattgctc ctcttctttg tatcctgtct tataatttca acacatttgc gatactcaat gtctattcta aattaaccat gttttgtacc acaaactcat tgcccatgga tctgttgctg aaacaaggaa gtcttaaaca agaagtggaa tctttctgtt atcagattgt gtctgaatca aatgatcaga aggttggaat attacaaagt gaagataagc agttgcaacc ttcagtttct aaaaaatcag aaggtgagct ttccagggtc aaatttatat ccaattccaa caaaataaca tttagtaaaa aaccaaaaag aagaaaatat gatgaaagtt atttgtcttt tggatttact tacttcggaa atagagatgc acctcatgct cagtgtgtat tatgtaagaa aattttatca aatagctctt tagcccctag taagcttcga agacatttgg aaactaaaca tgctgcatat aaagacaaag acataagctt tttcaagcaa catctcgatt cacctgaaaa taataaaccc ccaacaccta aaattgtgaa tacagataat gaaagtgcta cagaagcatc atacaatgta agttaccata tagcgctgag tggagaggct catactattg gagaattgct tatcaaacct tgtgcaaaag atgtagtgat gcggatgttt gatgaacaat atagtaaaaa aatagatgca gtacagctat caaacagtac tgttgcacgt cgaattaagg atctagctgc tgacattgaa gaagagcttg tttgtagact gaaaatttgc gatgggtttt cactgcaact agatgaatca gctgatgttt caggacttgc tgtgctgctt gtgtttgttc gttataggtt taataagtct attgaggaag acctactcct gtgtgaatct ttgcaaagta atgctaccgg tgaagaaata ttcaactgta tcaacagttt tatgcagaaa catgaaattg aatgggaaaa atgtgttgat gtttgtagtg atgcttctag ggcagtggat gggaaaattg ccgaagctgt caccttaata aaatatgtgg ctcccgaaag caccagtagt cactgcctat tatacagaca tgcactggca gttaaaataa tgcctacatc tctaaaaaat gtgctagacc aggcagtaca aatcatcaat tatattaaag ctcgaccaca tcaatccaga ctattaaaaa ttttatgtga ggaaatgggt gctcagcaca cagcacttct tctaaataca gaggtgaggt ggctttctcg aggtaaagtt cttgtaagac tttttgaact tcgtcgtgaa cttttggttt tcatggattc tgcttttcga ctatctgatt gtttaacaaa ttcatcttgg ctgctaagac ttgcatatct tgcagatatt tttactaaat taaatgaagt taatttgtca atgcaaggaa aaatgtga. It is sometimes possible for the material contained within the vial of "ZBED5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
