Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CFD cdna clone

CFD cDNA Clone

Gene Names
CFD; DF; ADN; PFD; ADIPSIN
Synonyms
CFD; CFD cDNA Clone; CFD cdna clone
Ordering
For Research Use Only!
Sequence
atgcacagctgggagcgcctggcagttctggtcctcctaggagcggccgcctgcgcggcgccgccccgtggtcggatcctgggcggcagagaggccgaggcgcacgcgcggccctacatggcgtcggtgcagctgaacggcgcgcacctgtgcggcggcgtcctggtggcggagcagtgggtgctgagcgcggcgcactgcctggaggacgcggccgacgggaaggtgcaggttctcctgggcgcgcactccctgtcgcagccggagccctccaagcgcctgtacgacgtgctccgcgcagtgccccacccggacagccagcccgacaccatcgaccacgacctcctgctgctacagctgtcggagaaggccacactgggccctgctgtgcgccccctgccctggcagcgcgtggaccgcgacgtggcaccgggaactctctgcgacgtggccggctggggcatagtcaaccacgcgggccgccgcccggacagcctgcagcacgtgctcttgccagtgctggaccgcgccacctgcaaccggcgcacgcaccacgacggcgccatcaccgagcgcttgatgtgcgcggagagcaatcgccgggacagctgcaagggtgactccgggggcccgctggtgtgcgggggcgtgctcgagggcgtggtcacctcgggctcgcgcgtttgcggcaaccgcaagaagcccgggatctacacccgcgtggcgagctatgcggcctggatcgacagcgtcctggcctag
Sequence Length
762
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,033 Da
NCBI Official Full Name
Homo sapiens complement factor D (adipsin), mRNA
NCBI Official Synonym Full Names
complement factor D
NCBI Official Symbol
CFD
NCBI Official Synonym Symbols
DF; ADN; PFD; ADIPSIN
NCBI Protein Information
complement factor D
UniProt Protein Name
Complement factor D
Protein Family
UniProt Gene Name
CFD
UniProt Synonym Gene Names
DF; PFD
UniProt Entry Name
CFAD_HUMAN

NCBI Description

This gene encodes a member of the S1, or chymotrypsin, family of serine peptidases. This protease catalyzes the cleavage of factor B, the rate-limiting step of the alternative pathway of complement activation. This protein also functions as an adipokine, a cell signaling protein secreted by adipocytes, which regulates insulin secretion in mice. Mutations in this gene underlie complement factor D deficiency, which is associated with recurrent bacterial meningitis infections in human patients. Alternative splicing of this gene results in multiple transcript variants. At least one of these variants encodes a preproprotein that is proteolytically processed to generate the mature protease. [provided by RefSeq, Nov 2015]

Uniprot Description

CFD: Factor D cleaves factor B when the latter is complexed with factor C3b, activating the C3bbb complex, which then becomes the C3 convertase of the alternate pathway. Its function is homologous to that of C1s in the classical pathway. Defects in CFD are the cause of complement factor D deficiency (CFDD). CFDD is an immunologic disorder characterized by increased susceptibility to bacterial infections, particularly Neisseria infections, due to a defect in the alternative complement pathway. Belongs to the peptidase S1 family.

Protein type: EC 3.4.21.46; Protease; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: extracellular region

Molecular Function: serine-type endopeptidase activity; serine-type peptidase activity

Biological Process: complement activation; complement activation, alternative pathway; platelet degranulation

Disease: Complement Factor D Deficiency

Research Articles on CFD

Similar Products

Product Notes

The CFD cfd (Catalog #AAA1273266) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacagct gggagcgcct ggcagttctg gtcctcctag gagcggccgc ctgcgcggcg ccgccccgtg gtcggatcct gggcggcaga gaggccgagg cgcacgcgcg gccctacatg gcgtcggtgc agctgaacgg cgcgcacctg tgcggcggcg tcctggtggc ggagcagtgg gtgctgagcg cggcgcactg cctggaggac gcggccgacg ggaaggtgca ggttctcctg ggcgcgcact ccctgtcgca gccggagccc tccaagcgcc tgtacgacgt gctccgcgca gtgccccacc cggacagcca gcccgacacc atcgaccacg acctcctgct gctacagctg tcggagaagg ccacactggg ccctgctgtg cgccccctgc cctggcagcg cgtggaccgc gacgtggcac cgggaactct ctgcgacgtg gccggctggg gcatagtcaa ccacgcgggc cgccgcccgg acagcctgca gcacgtgctc ttgccagtgc tggaccgcgc cacctgcaac cggcgcacgc accacgacgg cgccatcacc gagcgcttga tgtgcgcgga gagcaatcgc cgggacagct gcaagggtga ctccgggggc ccgctggtgt gcgggggcgt gctcgagggc gtggtcacct cgggctcgcg cgtttgcggc aaccgcaaga agcccgggat ctacacccgc gtggcgagct atgcggcctg gatcgacagc gtcctggcct ag. It is sometimes possible for the material contained within the vial of "CFD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.