ZNF688 cdna clone
ZNF688 cDNA Clone
Synonyms
ZNF688; ZNF688 cDNA Clone; ZNF688 cdna clone
Sequence
atggcgccgcccccagccccgctcctggcgccgaggcccggggagacccggcctggttgcaggaagcccgggactgtgagcttcgcggacgtggccgtgtacttctccccggaggagtggggctgtctgcggcccgcgcagagggctctgtaccgggacgtgatgcaggagacctacggccacctgggcgcgctcggattcccaggccccaaaccagccctcatctcttggatggaacaggagagtgaggcttggagccccgccgcccaggatcctgagaagggggaaagactgggaggagctcggagaggagatgtcccaaacaggaaggaagaggaaccggaggaagtcccaagagccaaagggcctagaaaggctcctgtgaaggagagtcctgaagtgctggtggaacgcaaccctgacccagctattagcgtggccccggcacgggcacagccacccaaaaatgctgcctgggacccgaccacaggagcacagcccccggcacccatacccagcatggatgctcaggccggccagcggcgccacgtgtgcacggactgcggccgccgcttcacctacccctcactgctggtcagccacaggcgcatgcactcgggggagcggcctttcccctgccccgagtgtggcatgcgcttcaagaggaagttcgcagtggaagcgcaccagtggatccaccgctcctgctccggggggcggcggggccggaggcctgggatccgggctgtgcctcgggcccccgtccgaggtgaccgggacccgcctgtgctcttccggcactacccagacatcttcgaggagtgcggctga
Sequence Length
831
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,905 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 688, mRNA
NCBI Official Synonym Full Names
zinc finger protein 688
NCBI Official Symbol
ZNF688
NCBI Protein Information
zinc finger protein 688
UniProt Protein Name
Zinc finger protein 688
Protein Family
UniProt Gene Name
ZNF688
UniProt Entry Name
ZN688_HUMAN
Similar Products
Product Notes
The ZNF688 znf688 (Catalog #AAA1273110) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccgc ccccagcccc gctcctggcg ccgaggcccg gggagacccg gcctggttgc aggaagcccg ggactgtgag cttcgcggac gtggccgtgt acttctcccc ggaggagtgg ggctgtctgc ggcccgcgca gagggctctg taccgggacg tgatgcagga gacctacggc cacctgggcg cgctcggatt cccaggcccc aaaccagccc tcatctcttg gatggaacag gagagtgagg cttggagccc cgccgcccag gatcctgaga agggggaaag actgggagga gctcggagag gagatgtccc aaacaggaag gaagaggaac cggaggaagt cccaagagcc aaagggccta gaaaggctcc tgtgaaggag agtcctgaag tgctggtgga acgcaaccct gacccagcta ttagcgtggc cccggcacgg gcacagccac ccaaaaatgc tgcctgggac ccgaccacag gagcacagcc cccggcaccc atacccagca tggatgctca ggccggccag cggcgccacg tgtgcacgga ctgcggccgc cgcttcacct acccctcact gctggtcagc cacaggcgca tgcactcggg ggagcggcct ttcccctgcc ccgagtgtgg catgcgcttc aagaggaagt tcgcagtgga agcgcaccag tggatccacc gctcctgctc cggggggcgg cggggccgga ggcctgggat ccgggctgtg cctcgggccc ccgtccgagg tgaccgggac ccgcctgtgc tcttccggca ctacccagac atcttcgagg agtgcggctg a. It is sometimes possible for the material contained within the vial of "ZNF688, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
