ZCCHC4 cdna clone
ZCCHC4 cDNA Clone
Gene Names
ZCCHC4; ZGRF4; HSPC052
Synonyms
ZCCHC4; ZCCHC4 cDNA Clone; ZCCHC4 cdna clone
Sequence
atggaggtggtgcttcctttggatcctgccgtccccgccccgctgtgccctcacggacccactcttctgtttgtaaaggtgacccaagggaaagaagaaactcggaggttttatgcctgttcagcctgtagagatagaaaagactgtaatttttttcagtgggaagatgaaaagttgtcaggagctagacttgctgcccgagaagctcataaccgaagatgtcagcctcccctgtcccgaacgcagtgtgtggaaaggtacttgaagtttattgagttgcccttgactcagagaaagttttgtcaaacatgtcagcagttgttgttaccagatgactgggggcaacatagtgagcatcaggttctgggtaatgtgtccattacccagttaagaaggcccagtcaactcctttatccactggaaaacaagaagacaaatgcccagtatctgtttgctgatcggagctgtcagttcttggtagacttactttctgccctcggattcagaagagtactgtgtgttggaacaccaaggttgcatgagctgatcaagttgacagcatcaggtgacaagaagtctaacattaaaagccttttattggatattgattttcggtag
Sequence Length
618
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
58,683 Da
NCBI Official Full Name
Homo sapiens zinc finger, CCHC domain containing 4, mRNA
NCBI Official Synonym Full Names
zinc finger CCHC-type containing 4
NCBI Official Symbol
ZCCHC4
NCBI Official Synonym Symbols
ZGRF4; HSPC052
NCBI Protein Information
zinc finger CCHC domain-containing protein 4
UniProt Protein Name
Zinc finger CCHC domain-containing protein 4
Protein Family
UniProt Gene Name
ZCCHC4
UniProt Entry Name
ZCHC4_HUMAN
Uniprot Description
ZCCHC4: May be a methyltransferase. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 4p15.2
Similar Products
Product Notes
The ZCCHC4 zcchc4 (Catalog #AAA1273094) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggtgg tgcttccttt ggatcctgcc gtccccgccc cgctgtgccc tcacggaccc actcttctgt ttgtaaaggt gacccaaggg aaagaagaaa ctcggaggtt ttatgcctgt tcagcctgta gagatagaaa agactgtaat ttttttcagt gggaagatga aaagttgtca ggagctagac ttgctgcccg agaagctcat aaccgaagat gtcagcctcc cctgtcccga acgcagtgtg tggaaaggta cttgaagttt attgagttgc ccttgactca gagaaagttt tgtcaaacat gtcagcagtt gttgttacca gatgactggg ggcaacatag tgagcatcag gttctgggta atgtgtccat tacccagtta agaaggccca gtcaactcct ttatccactg gaaaacaaga agacaaatgc ccagtatctg tttgctgatc ggagctgtca gttcttggta gacttacttt ctgccctcgg attcagaaga gtactgtgtg ttggaacacc aaggttgcat gagctgatca agttgacagc atcaggtgac aagaagtcta acattaaaag ccttttattg gatattgatt ttcggtag. It is sometimes possible for the material contained within the vial of "ZCCHC4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
