Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLTA cdna clone

CLTA cDNA Clone

Gene Names
CLTA; LCA
Synonyms
CLTA; CLTA cDNA Clone; CLTA cdna clone
Ordering
For Research Use Only!
Sequence
atggctgagctggatccgttcggcgcccctgccggcgcccctggcggtcccgcgctggggaacggagtggccggcgccggcgaagaagacccggctgcggccttcttggcgcagcaagagagcgagattgcgggcatcgagaacgacgaggccttcgccatcctggacggcggcgcccccgggccccagccgcacggcgagccgccggggggtccggatgctgttgatggagtaatgaatggtgaatactaccaggaaagtaatggtccaacagacagttatgcagctatttcacaagtggatcgattgcagtcagagcctgaaagtatccgtaaatggagagaagaacaaatggaacgcttggaagcccttgatgccaattctcggaagcaagaagcagagtggaaagaaaaggcaataaaggagctagaagaatggtatgcaagacaggacgagcagctacagaaaacaaaagcaaacaacagggcagcagaagaagcctttgtaaatgacattgacgagtcgtccccaggcactgagtgggaacgggtggcccggctgtgtgactttaaccccaagtctagcaagcaggccaaagatgtctcccgcatgcgctcagtcctcatctccctcaagcaggccccgctggtgcactga
Sequence Length
657
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,687 Da
NCBI Official Full Name
Homo sapiens clathrin, light chain (Lca), mRNA
NCBI Official Synonym Full Names
clathrin light chain A
NCBI Official Symbol
CLTA
NCBI Official Synonym Symbols
LCA
UniProt Protein Name
Clathrin light chain A
Protein Family
UniProt Gene Name
CLTA
UniProt Synonym Gene Names
Lca
UniProt Entry Name
CLCA_HUMAN

NCBI Description

Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, May 2010]

Uniprot Description

CLTA: Clathrin is the major protein of the polyhedral coat of coated pits and vesicles. Belongs to the clathrin light chain family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Vesicle

Chromosomal Location of Human Ortholog: 9p13

Cellular Component: clathrin vesicle coat; cytoplasmic membrane-bound vesicle; cytosol; intracellular membrane-bound organelle; membrane; plasma membrane; trans-Golgi network membrane

Molecular Function: clathrin heavy chain binding; protein binding; structural molecule activity

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; microtubule-based movement; negative regulation of epidermal growth factor receptor signaling pathway

Research Articles on CLTA

Similar Products

Product Notes

The CLTA clta (Catalog #AAA1272768) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgagc tggatccgtt cggcgcccct gccggcgccc ctggcggtcc cgcgctgggg aacggagtgg ccggcgccgg cgaagaagac ccggctgcgg ccttcttggc gcagcaagag agcgagattg cgggcatcga gaacgacgag gccttcgcca tcctggacgg cggcgccccc gggccccagc cgcacggcga gccgccgggg ggtccggatg ctgttgatgg agtaatgaat ggtgaatact accaggaaag taatggtcca acagacagtt atgcagctat ttcacaagtg gatcgattgc agtcagagcc tgaaagtatc cgtaaatgga gagaagaaca aatggaacgc ttggaagccc ttgatgccaa ttctcggaag caagaagcag agtggaaaga aaaggcaata aaggagctag aagaatggta tgcaagacag gacgagcagc tacagaaaac aaaagcaaac aacagggcag cagaagaagc ctttgtaaat gacattgacg agtcgtcccc aggcactgag tgggaacggg tggcccggct gtgtgacttt aaccccaagt ctagcaagca ggccaaagat gtctcccgca tgcgctcagt cctcatctcc ctcaagcagg ccccgctggt gcactga. It is sometimes possible for the material contained within the vial of "CLTA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.