Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF385D cdna clone

ZNF385D cDNA Clone

Gene Names
ZNF385D; ZNF659
Synonyms
ZNF385D; ZNF385D cDNA Clone; ZNF385D cdna clone
Ordering
For Research Use Only!
Sequence
atgagaaacataatgtattttggtggtacatgccagagtcctgctctcccggcccttgtccgtccaccagcccctcctttgcaaccatcgctggatattaaaccatttcttccctttcctcttgacactgcagctgcagtcaacctcttccccaatttcaatgcgatggacccgattcagaaagctgtaataaaccatacattcggggttcctcttccccaccgaagaaagcaaatcatatcatgcaacatttgccagttgagatttaattctgatagccaggctgcggcccactacaaaggcacgaaacatgccaagaagctcaaagcactggaagccatgaaaaataagcagaaatctgtaactgccaaggacagcgcaaagactaccttcacctccatcactaccaataccatcaataccagctctgacaaaacagacggtactgcagggacaccagcaatatcaacgacgacaactgtggaaatccgcaaaagcagtgttatgacaactgagatcacctctaaagtggaaaaaagcccaacgacagccactggcaatagctcatgtccttctactgagaccgaggaagaaaaggcaaaacggcttctttactgttcgctatgcaaggttgctgtcaactctgcctcgcagctggaggcgcacaacagtggtactaagcacaaaaccatgttagaagcccggaatggaagtggcactatcaaagcctttcctagggcaggagtgaaaggcaaaggacctgttaataaaggaaacacaggcctccaaaataaaacatttcactgtgaaatctgtgatgtgcacgtcaactcggaaacgcaacttaaacagcacattagcagtagaaggcacaaagacagagctgctgggaagcccccgaaacctaaatacagtccttacaacaaactacagaagacagcacatccactgggggtaaaattagtattttcaaaagaaccttcaaagccattggctccacgaattctaccaaaccctctagcagctgcagcagccgcagcagcagtggcagtgagttcccccttcagtcttcgaactgctccagcagcaacactgttccagacttctgcgcttcctccggcactcctgcggccagctcccggacccattcggaccgcccacactcctgtgctgtttgctccttactaa
Sequence Length
1188
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,296 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 385D, mRNA
NCBI Official Synonym Full Names
zinc finger protein 385D
NCBI Official Symbol
ZNF385D
NCBI Official Synonym Symbols
ZNF659
NCBI Protein Information
zinc finger protein 385D
UniProt Protein Name
Zinc finger protein 385D
Protein Family
UniProt Gene Name
ZNF385D
UniProt Synonym Gene Names
ZNF659
UniProt Entry Name
Z385D_HUMAN

Uniprot Description

ZNF659:

Chromosomal Location of Human Ortholog: 3p24.3

Molecular Function: p53 binding; RNA binding

Research Articles on ZNF385D

Similar Products

Product Notes

The ZNF385D znf385d (Catalog #AAA1272442) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagaaaca taatgtattt tggtggtaca tgccagagtc ctgctctccc ggcccttgtc cgtccaccag cccctccttt gcaaccatcg ctggatatta aaccatttct tccctttcct cttgacactg cagctgcagt caacctcttc cccaatttca atgcgatgga cccgattcag aaagctgtaa taaaccatac attcggggtt cctcttcccc accgaagaaa gcaaatcata tcatgcaaca tttgccagtt gagatttaat tctgatagcc aggctgcggc ccactacaaa ggcacgaaac atgccaagaa gctcaaagca ctggaagcca tgaaaaataa gcagaaatct gtaactgcca aggacagcgc aaagactacc ttcacctcca tcactaccaa taccatcaat accagctctg acaaaacaga cggtactgca gggacaccag caatatcaac gacgacaact gtggaaatcc gcaaaagcag tgttatgaca actgagatca cctctaaagt ggaaaaaagc ccaacgacag ccactggcaa tagctcatgt ccttctactg agaccgagga agaaaaggca aaacggcttc tttactgttc gctatgcaag gttgctgtca actctgcctc gcagctggag gcgcacaaca gtggtactaa gcacaaaacc atgttagaag cccggaatgg aagtggcact atcaaagcct ttcctagggc aggagtgaaa ggcaaaggac ctgttaataa aggaaacaca ggcctccaaa ataaaacatt tcactgtgaa atctgtgatg tgcacgtcaa ctcggaaacg caacttaaac agcacattag cagtagaagg cacaaagaca gagctgctgg gaagcccccg aaacctaaat acagtcctta caacaaacta cagaagacag cacatccact gggggtaaaa ttagtatttt caaaagaacc ttcaaagcca ttggctccac gaattctacc aaaccctcta gcagctgcag cagccgcagc agcagtggca gtgagttccc ccttcagtct tcgaactgct ccagcagcaa cactgttcca gacttctgcg cttcctccgg cactcctgcg gccagctccc ggacccattc ggaccgccca cactcctgtg ctgtttgctc cttactaa. It is sometimes possible for the material contained within the vial of "ZNF385D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.