ZDHHC2 cdna clone

ZDHHC2 cDNA Clone

Gene Names

ZDHHC2; DHHC2; ZNF372

Synonyms

ZDHHC2; ZDHHC2 cDNA Clone; ZDHHC2 cdna clone

Ordering
Cat. Num. AAA1271445 For Research Use Only!

Sequence

atggcgccctcgggcccgggcagcagcgccaggcggcggtgccggcgggtgctgtactggatcccggtggtgttcatcaccctcctgctcggctggtcctactacgcctacgccatccagctgtgcatagtgtccatggaaaacactggcgaacaagttgtgtgcctgatggcctatcatctactttttgcaatgtttgtctggtcatactggaaaactatctttacattaccaatgaatccttcaaaagaattccatctctcttatgcagagaaagatttgttggagagagagccaagaggagaagcccatcaggaagttcttaggcgagcagccaaggatcttcccatctataccaggaccatgtctggagccatccgatactgtgacagatgccaacttataaaaccagatcgctgccatcactgctccgtctgtgataaatgtattttgaagatggatcatcattgtccatgggtgaacaattgtgttggattttcaaattataagttctttctccttttcttggcttattctctgctctactgcctttttattgcggcaacagatttacagtattttatcaaattttggacaaatggcctacctgatactcaagccaagttccatattatgtttttattctttgctgcagctatgttttctgtcagcttgtcttctctgtttggctatcattgttggctagtcagcaaaaataaatctacattagaggcattcagaagtccagtatttcgacatggaacagataagaatggattcagcttgggtttcagtaaaaacatgcgacaagtttttggtgatgagaagaagtactggttgctacccattttttcaagtctaggtgatggctgctcctttccaacttgccttgttaaccaggatcctgaacaagcatctactcctgcagggctgaattccacagctaaaaatctcgaaaaccatcagtttcctgcaaagccattgagagagtcccagagccaccttcttactgattctcagtcttggacggagagcagcataaacccaggaaaatgcaaagctggtatgagcaatcctgcattaaccatggaaaatgagacttaa

Sequence Length

1104

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

24659671

NCBI GeneID

51201

Molecular Weight

42,022 Da

NCBI Official Full Name

Homo sapiens zinc finger, DHHC-type containing 2, mRNA

NCBI Official Synonym Full Names

zinc finger DHHC-type containing 2

NCBI Official Symbol

ZDHHC2

NCBI Official Synonym Symbols

DHHC2; ZNF372

NCBI Protein Information

palmitoyltransferase ZDHHC2

UniProt Protein Name

Palmitoyltransferase ZDHHC2

Protein Family

Palmitoyltransferase

UniProt Gene Name

ZDHHC2

UniProt Synonym Gene Names

REAM; REC; ZNF372; Ream; Rec; DHHC-2

UniProt Entry Name

ZDHC2_HUMAN

Uniprot Description

ZDHHC2: Palmitoyltransferase specific for GAP43 and DLG4/PSD95. Mutations in ZDHHC2 are found in hepatocellular carcinoma and colorectal cancer. Belongs to the DHHC palmitoyltransferase family.

Protein type: EC 2.3.1.225; Membrane protein, integral; Membrane protein, multi-pass; Transferase

Chromosomal Location of Human Ortholog: 8p22

Cellular Component: endoplasmic reticulum; Golgi apparatus; plasma membrane

Molecular Function: palmitoyltransferase activity

Biological Process: cellular protein metabolic process; protein palmitoylation

Research Articles on ZDHHC2

1. These results suggest an important role for ZDHHC2 as a tumor suppressor in metastasis and recurrence of HCC.

Similar Products

Product Notes

The ZDHHC2 zdhhc2 (Catalog #AAA1271445) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccct cgggcccggg cagcagcgcc aggcggcggt gccggcgggt gctgtactgg atcccggtgg tgttcatcac cctcctgctc ggctggtcct actacgccta cgccatccag ctgtgcatag tgtccatgga aaacactggc gaacaagttg tgtgcctgat ggcctatcat ctactttttg caatgtttgt ctggtcatac tggaaaacta tctttacatt accaatgaat ccttcaaaag aattccatct ctcttatgca gagaaagatt tgttggagag agagccaaga ggagaagccc atcaggaagt tcttaggcga gcagccaagg atcttcccat ctataccagg accatgtctg gagccatccg atactgtgac agatgccaac ttataaaacc agatcgctgc catcactgct ccgtctgtga taaatgtatt ttgaagatgg atcatcattg tccatgggtg aacaattgtg ttggattttc aaattataag ttctttctcc ttttcttggc ttattctctg ctctactgcc tttttattgc ggcaacagat ttacagtatt ttatcaaatt ttggacaaat ggcctacctg atactcaagc caagttccat attatgtttt tattctttgc tgcagctatg ttttctgtca gcttgtcttc tctgtttggc tatcattgtt ggctagtcag caaaaataaa tctacattag aggcattcag aagtccagta tttcgacatg gaacagataa gaatggattc agcttgggtt tcagtaaaaa catgcgacaa gtttttggtg atgagaagaa gtactggttg ctacccattt tttcaagtct aggtgatggc tgctcctttc caacttgcct tgttaaccag gatcctgaac aagcatctac tcctgcaggg ctgaattcca cagctaaaaa tctcgaaaac catcagtttc ctgcaaagcc attgagagag tcccagagcc accttcttac tgattctcag tcttggacgg agagcagcat aaacccagga aaatgcaaag ctggtatgag caatcctgca ttaaccatgg aaaatgagac ttaa. It is sometimes possible for the material contained within the vial of "ZDHHC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ZDHHC2 cdna clone