KLC3 cdna clone
KLC3 cDNA Clone
Gene Names
KLC3; KLC2; KLCt; KLC2L; KNS2B
Synonyms
KLC3; KLC3 cDNA Clone; KLC3 cdna clone
Sequence
atgtctgtgcaggtagcggctcctggaagtgcagggctgggcccagagcgcctgagccctgaggagctggtgcggcagacgcggcaagtggtccaggggctggaggcgctgcgggcagagcaccatggcctggctgggcacctggcggaggccctggcgggacagggcccggcagccggcttggagatgctggaggaaaagcagcaggtggtgagccactcgctggaggccatcgagctggggctgggcgaggcccaggtgctgctggccctgtcggcacatgtgggtgcactggaggcagagaagcagcggctgcgctcgcaggcccggcggctggcccaggagaacgtgtggctgcgggaggaactggaggagacgcagcggcggcttcgggccagcgaggagtccgtggcccagctggaggaggagaagcgccacctggagttcctggggcagctgcgacagtacgacccaccggcggagagccagtctgagtccccgcctcgccgagacagcctggcctccctgttccccagcgaggaggaggagaggaaaggtcctgaggccgcaggagcagcagctgctcagcagggtggctatgagatccctgcccgccttcggaccctgcataacctcgtgatccagtacgcggggcagggccgctatgaggtggcggtgcctctgtgccgccaggccttggaggacctggagcgcagctcgggccactgccaccctgacgtggccaccatgctcaacatcctggcgctggtgtaccgggaccagaacaagtacaaagaagccacagaccttctccatgatgccctgcagatccgggagcagacgctgggccctgagcaccccgcggtggccgccacgctcaacaacttggctgtcctctatgggaagcgtgggcgttaccgggaggcagagcccctgtgccagcgcgctttggagatccgagagaaggtcctgggtgctgaccacccagatgtggccaagcagctcaacaacctggccctgctgtgccagaaccagggcaagtttgaggacgtggagcggcactatgcccgggccctgagcatctatgaggcactgggcgggccccatgaccccaacgtggccaagaccaagaacaacctggcctcagcctacctgaaacagaacaagtatcaacaagcggaagagctgtacaaagaaatcctccacaaggaggacctacccgcccctctcggtgcccccaacacaggcacagctggtgacgcagaacaggcccttcgccgcagcagctcactctccaagatccgtgagtctatcaggcgaggaagtgagaagctggtctcccggctccgaggcgaggcggcggcaggagcagccggaatgaagagagccatgtcactcaacacactgaacgtggatgctccaagggctcctgggactcagtttcccagctggcacctggacaaggcccctcggaccctcagcgccagcacccaggacctgagcccccactaa
Sequence Length
1512
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
56,793 Da
NCBI Official Full Name
Homo sapiens kinesin light chain 3, mRNA
NCBI Official Synonym Full Names
kinesin light chain 3
NCBI Official Symbol
KLC3
NCBI Official Synonym Symbols
KLC2; KLCt; KLC2L; KNS2B
NCBI Protein Information
kinesin light chain 3
UniProt Protein Name
Kinesin light chain 3
Protein Family
UniProt Gene Name
KLC3
UniProt Synonym Gene Names
KLC2; KLC2L
UniProt Entry Name
KLC3_HUMAN
NCBI Description
This gene encodes a member of the kinesin light chain gene family. Kinesins are molecular motors involved in the transport of cargo along microtubules, and are composed of two kinesin heavy chain (KHC) and two kinesin light chain (KLC) molecules. KLCs are thought to typically be involved in binding cargo and regulating kinesin activity. In the rat, a protein similar to this gene product is expressed in post-meiotic spermatids, where it associates with structural components of sperm tails and mitochondria. [provided by RefSeq, Jul 2008]
Uniprot Description
KLC3: Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. Belongs to the kinesin light chain family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Microtubule-binding; Motor
Chromosomal Location of Human Ortholog: 19q13
Molecular Function: protein binding
Research Articles on KLC3
Similar Products
Product Notes
The KLC3 klc3 (Catalog #AAA1271310) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgtgc aggtagcggc tcctggaagt gcagggctgg gcccagagcg cctgagccct gaggagctgg tgcggcagac gcggcaagtg gtccaggggc tggaggcgct gcgggcagag caccatggcc tggctgggca cctggcggag gccctggcgg gacagggccc ggcagccggc ttggagatgc tggaggaaaa gcagcaggtg gtgagccact cgctggaggc catcgagctg gggctgggcg aggcccaggt gctgctggcc ctgtcggcac atgtgggtgc actggaggca gagaagcagc ggctgcgctc gcaggcccgg cggctggccc aggagaacgt gtggctgcgg gaggaactgg aggagacgca gcggcggctt cgggccagcg aggagtccgt ggcccagctg gaggaggaga agcgccacct ggagttcctg gggcagctgc gacagtacga cccaccggcg gagagccagt ctgagtcccc gcctcgccga gacagcctgg cctccctgtt ccccagcgag gaggaggaga ggaaaggtcc tgaggccgca ggagcagcag ctgctcagca gggtggctat gagatccctg cccgccttcg gaccctgcat aacctcgtga tccagtacgc ggggcagggc cgctatgagg tggcggtgcc tctgtgccgc caggccttgg aggacctgga gcgcagctcg ggccactgcc accctgacgt ggccaccatg ctcaacatcc tggcgctggt gtaccgggac cagaacaagt acaaagaagc cacagacctt ctccatgatg ccctgcagat ccgggagcag acgctgggcc ctgagcaccc cgcggtggcc gccacgctca acaacttggc tgtcctctat gggaagcgtg ggcgttaccg ggaggcagag cccctgtgcc agcgcgcttt ggagatccga gagaaggtcc tgggtgctga ccacccagat gtggccaagc agctcaacaa cctggccctg ctgtgccaga accagggcaa gtttgaggac gtggagcggc actatgcccg ggccctgagc atctatgagg cactgggcgg gccccatgac cccaacgtgg ccaagaccaa gaacaacctg gcctcagcct acctgaaaca gaacaagtat caacaagcgg aagagctgta caaagaaatc ctccacaagg aggacctacc cgcccctctc ggtgccccca acacaggcac agctggtgac gcagaacagg cccttcgccg cagcagctca ctctccaaga tccgtgagtc tatcaggcga ggaagtgaga agctggtctc ccggctccga ggcgaggcgg cggcaggagc agccggaatg aagagagcca tgtcactcaa cacactgaac gtggatgctc caagggctcc tgggactcag tttcccagct ggcacctgga caaggcccct cggaccctca gcgccagcac ccaggacctg agcccccact aa. It is sometimes possible for the material contained within the vial of "KLC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
