Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF397 cdna clone

ZNF397 cDNA Clone

Gene Names
ZNF397; ZNF47; ZSCAN15
Synonyms
ZNF397; ZNF397 cDNA Clone; ZNF397 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgtggaatctggagtgatttcaaccctgatacctcaggatcctccggaacaagaactaatactagtgaaagtagaagataacttttcctgggatgagaaatttaagcagaatgggagtactcaatcctgccaagaattgtttcgtcagcaattcagaaaattttgctaccaggagacacctgggccccgggaggctctgagccgactccaggaactttgctatcagtggctaatgccagagttgcacacaaaggagcagatcttagaactgctggtactggagcagttcctgagcattctgcctgaggagctgcagatctgggttcagcaacataatccagaaagcggcgaggaagctgtgaccctgttggaggatttagagagggagtttgatgacccagggcagcaggtcccagctagtccacagggaccagcagtgccatggaaggatttaacatgtctcagagcatcccaagagtcaacagacatccacctccagcccttaaagacacagctgaaatcctggaaaccatgcctttcccctaaaagtgattgtgagaacagtgaaacagcaacaaaagagggcatctcagaagaaaaatcacagggactccctcaggaaccttcatttcgaggaattaagttgtccagacctcccaaagcttcttcagctatccgttgggaatgtgtttctccaggaagttttcccggcgatatcatagctgctgaggctacacattcaacaatttcttgctttgccatcaacactttgccagccaccatcctgccatctaaaaatgtgaatagaaagtatttttcctga
Sequence Length
828
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,141 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 397, mRNA
NCBI Official Synonym Full Names
zinc finger protein 397
NCBI Official Symbol
ZNF397
NCBI Official Synonym Symbols
ZNF47; ZSCAN15
NCBI Protein Information
zinc finger protein 397
UniProt Protein Name
Zinc finger protein 397
Protein Family
UniProt Gene Name
ZNF397
UniProt Synonym Gene Names
ZNF47; ZSCAN15
UniProt Entry Name
ZN397_HUMAN

NCBI Description

This gene encodes a protein with a N-terminal SCAN domain, and the longer isoform contains nine C2H2-type zinc finger repeats in the C-terminal domain. The protein localizes to centromeres during interphase and early prophase, and different isoforms can repress or activate transcription in transfection studies. Multiple transcript variants encoding different isoforms have been found for this gene. Additional variants have been described, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]

Uniprot Description

ZNF397: Isoform 3 acts as a DNA-dependent transcriptional repressor. Belongs to the krueppel C2H2-type zinc-finger protein family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 18q12.2

Cellular Component: nucleus

Molecular Function: protein binding; sequence-specific DNA binding; transcription factor activity

Research Articles on ZNF397

Similar Products

Product Notes

The ZNF397 znf397 (Catalog #AAA1271083) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgtgg aatctggagt gatttcaacc ctgatacctc aggatcctcc ggaacaagaa ctaatactag tgaaagtaga agataacttt tcctgggatg agaaatttaa gcagaatggg agtactcaat cctgccaaga attgtttcgt cagcaattca gaaaattttg ctaccaggag acacctgggc cccgggaggc tctgagccga ctccaggaac tttgctatca gtggctaatg ccagagttgc acacaaagga gcagatctta gaactgctgg tactggagca gttcctgagc attctgcctg aggagctgca gatctgggtt cagcaacata atccagaaag cggcgaggaa gctgtgaccc tgttggagga tttagagagg gagtttgatg acccagggca gcaggtccca gctagtccac agggaccagc agtgccatgg aaggatttaa catgtctcag agcatcccaa gagtcaacag acatccacct ccagccctta aagacacagc tgaaatcctg gaaaccatgc ctttccccta aaagtgattg tgagaacagt gaaacagcaa caaaagaggg catctcagaa gaaaaatcac agggactccc tcaggaacct tcatttcgag gaattaagtt gtccagacct cccaaagctt cttcagctat ccgttgggaa tgtgtttctc caggaagttt tcccggcgat atcatagctg ctgaggctac acattcaaca atttcttgct ttgccatcaa cactttgcca gccaccatcc tgccatctaa aaatgtgaat agaaagtatt tttcctga. It is sometimes possible for the material contained within the vial of "ZNF397, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.