Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IRF2 cdna clone

IRF2 cDNA Clone

Synonyms
IRF2; IRF2 cDNA Clone; IRF2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggtggaaaggatgcgcatgcgcccgtggctggaggagcagataaactccaacacgatcccggggctcaagtggcttaacaaggaaaagaagatttttcagatcccctggatgcatgcggctagacatgggtgggatgtggaaaaagatgcaccactctttagaaactgggcaatccatacaggaaagcatcaaccaggagtagataaacctgatcccaaaacatggaaggcgaatttcagatgcgccatgaattccttgcctgatattgaagaagtcaaggataaaagcataaagaaaggaaataatgccttcagggtctaccgaatgctgcccctatcagaacggccttctaagaaaggaaagaaaccaaagacagaaaaagaagacaaagttaagcacatcaagcaagaaccagttgagtcatctctggggcttagtaatggagtaagtgatctttctcctgagtatgcggtcctgacttcaactataaaaaatgaagtggatagtacggtgaacatcatagttgtaggacagtcccatctggacagcaacattgagaatcaagagattgtcaccaatccgccagacatttgccaagttgtagaggtgaccactgagagcgacgagcagccggtcagcatgagcgagctctaccctctgcagatctcccccgtgtcttcctatgcagaaagcgaaacgactgatagtgtgcccagcgatgaagagagtgccgaggggcggccacactggcggaagaggaatattgaaggcaaacagtacctcagcaacatggggactcgaggctcctacctgctgcccggcatggcgtccttcgtcacttccaacaaaccggacctccaggtcaccatcaaagaggagagcaatccggtgccttacaacagctcctggcccccttttcaagacctccccctttcttcctccatgaccccagcatccagcagcagtcggccagaccgggagacccgggccagcgtcatcaagaaaacatcggatatcacccaggcccgcgtcaagagctgttaa
Sequence Length
1050
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,156 Da
NCBI Official Full Name
Homo sapiens interferon regulatory factor 2, mRNA
UniProt Protein Name
Interferon regulatory factor 2
UniProt Gene Name
IRF2
UniProt Synonym Gene Names
IRF-2
UniProt Entry Name
IRF2_HUMAN

Uniprot Description

IRF2: Specifically binds to the upstream regulatory region of type I IFN and IFN-inducible MHC class I genes (the interferon consensus sequence (ICS)) and represses those genes. Also acts as an activator for several genes including H4 and IL7. Constitutively binds to the ISRE promoter to activate IL7. Involved in cell cycle regulation through binding the site II (HiNF-M) promoter region of H4 and activating transcription during cell growth. Antagonizes IRF1 transcriptional activation. Interacts with BRD7, IRF2BP1 and IRF2BP2. Interacts with CREBBP in growing cells; the interaction acetylates IRF2 and regulates IRF2-dependent H4 promoter activity. By viruses and IFN. Expressed throughout the epithelium of the colon. Also expressed in lamina propria. Belongs to the IRF family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 4q34.1-q35.1

Cellular Component: cytoplasm; cytosol; focal adhesion; nucleoplasm

Molecular Function: DNA binding; protein binding; transcription factor activity

Biological Process: blood coagulation; negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter; regulation of transcription, DNA-dependent

Similar Products

Product Notes

The IRF2 irf2 (Catalog #AAA1270773) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggtgg aaaggatgcg catgcgcccg tggctggagg agcagataaa ctccaacacg atcccggggc tcaagtggct taacaaggaa aagaagattt ttcagatccc ctggatgcat gcggctagac atgggtggga tgtggaaaaa gatgcaccac tctttagaaa ctgggcaatc catacaggaa agcatcaacc aggagtagat aaacctgatc ccaaaacatg gaaggcgaat ttcagatgcg ccatgaattc cttgcctgat attgaagaag tcaaggataa aagcataaag aaaggaaata atgccttcag ggtctaccga atgctgcccc tatcagaacg gccttctaag aaaggaaaga aaccaaagac agaaaaagaa gacaaagtta agcacatcaa gcaagaacca gttgagtcat ctctggggct tagtaatgga gtaagtgatc tttctcctga gtatgcggtc ctgacttcaa ctataaaaaa tgaagtggat agtacggtga acatcatagt tgtaggacag tcccatctgg acagcaacat tgagaatcaa gagattgtca ccaatccgcc agacatttgc caagttgtag aggtgaccac tgagagcgac gagcagccgg tcagcatgag cgagctctac cctctgcaga tctcccccgt gtcttcctat gcagaaagcg aaacgactga tagtgtgccc agcgatgaag agagtgccga ggggcggcca cactggcgga agaggaatat tgaaggcaaa cagtacctca gcaacatggg gactcgaggc tcctacctgc tgcccggcat ggcgtccttc gtcacttcca acaaaccgga cctccaggtc accatcaaag aggagagcaa tccggtgcct tacaacagct cctggccccc ttttcaagac ctcccccttt cttcctccat gaccccagca tccagcagca gtcggccaga ccgggagacc cgggccagcg tcatcaagaa aacatcggat atcacccagg cccgcgtcaa gagctgttaa. It is sometimes possible for the material contained within the vial of "IRF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.