ZSWIM1 cdna clone
ZSWIM1 cDNA Clone
Gene Names
ZSWIM1; C20orf162
Synonyms
ZSWIM1; ZSWIM1 cDNA Clone; ZSWIM1 cdna clone
Sequence
atggccctgacaatgctgaatgggctcctgattaaggactcaagcccacctatgctgctgcaccaggttaacaagactgcccagttagataccttcaactaccagagctgctttatgcaaagtgtctttgaccatttccctgagatcttatttatccaccggacctataacccaaggggtaaggtcttatataccttcctggtggatggacctcgggtgcagctggagggtcatcttgcccgagcagtctactttgccatccctgccaaggaggacactgaaggcctggcccagatgttccaagtattcaagaagtttaatccagcatgggagagagtctgtaccatcctggtggatcctcatttccttccactgcctatcctagctatggagttccccacagctgaggtccttctctcagccttccacatttgtaagttcctccaggccaagttctatcagctgtcccttgaacggcccgtggaaaggctgctcctgacctccctgcagagcacaatgtgctcagccacagcaggcaacctgagaaagttgtatacactcctgagcaactgcatccctccagccaagctgcccgagcttcactcacactggctgctcaacgaccgcatctggctggctcaccgctggagaagccgagctgagagcagccactacttccagagcctcgaggtcaccacccacatcctcagccagttctttggtaccaccccatctgagaaacaaggtatggcttctctgttccgttacatgcagcagaactctgcagacaaggcaaacttcaaccagggcctgtgtgcccagaacaatcatgctccctcagacaccatccccgaaagccccaaactggagcagctggtagaatcccacatccagcactccctcaatgccatctgcacagggccagcagcccaactgtgcctgggcgagcttgctgtggtccagaaatccacacacctcattggctctggctcagaaaagatgaacatacagatcctggaagatacccataaggtgcagccccagccccctgccagctgcagctgctactttaaccaggccttccacctgccctgccgccacatcctagccatgctcagtgcccgccgccaggtgctccagcccgacatgctgccggctcagtggacggcaggctgtgctaccagtctagacagcatcctgggcagcaagtggagtgagaccctggataagcacctggcagtgactcacctcaccgaggaggtgggtcagctgttgcagcactgcaccaaggaggagtttgagcggaggtatagcaccctgcgggaactggccgacagctggattgggccttatgagcaggtccaactctga
Sequence Length
1371
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,071 Da
NCBI Official Full Name
Homo sapiens zinc finger, SWIM-type containing 1, mRNA
NCBI Official Synonym Full Names
zinc finger SWIM-type containing 1
NCBI Official Symbol
ZSWIM1
NCBI Official Synonym Symbols
C20orf162
NCBI Protein Information
zinc finger SWIM domain-containing protein 1
UniProt Protein Name
Zinc finger SWIM domain-containing protein 1
Protein Family
UniProt Gene Name
ZSWIM1
UniProt Synonym Gene Names
C20orf162
UniProt Entry Name
ZSWM1_HUMAN
Uniprot Description
ZSWIM1:
Chromosomal Location of Human Ortholog: 20q13.12
Research Articles on ZSWIM1
Similar Products
Product Notes
The ZSWIM1 zswim1 (Catalog #AAA1270399) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctga caatgctgaa tgggctcctg attaaggact caagcccacc tatgctgctg caccaggtta acaagactgc ccagttagat accttcaact accagagctg ctttatgcaa agtgtctttg accatttccc tgagatctta tttatccacc ggacctataa cccaaggggt aaggtcttat ataccttcct ggtggatgga cctcgggtgc agctggaggg tcatcttgcc cgagcagtct actttgccat ccctgccaag gaggacactg aaggcctggc ccagatgttc caagtattca agaagtttaa tccagcatgg gagagagtct gtaccatcct ggtggatcct catttccttc cactgcctat cctagctatg gagttcccca cagctgaggt ccttctctca gccttccaca tttgtaagtt cctccaggcc aagttctatc agctgtccct tgaacggccc gtggaaaggc tgctcctgac ctccctgcag agcacaatgt gctcagccac agcaggcaac ctgagaaagt tgtatacact cctgagcaac tgcatccctc cagccaagct gcccgagctt cactcacact ggctgctcaa cgaccgcatc tggctggctc accgctggag aagccgagct gagagcagcc actacttcca gagcctcgag gtcaccaccc acatcctcag ccagttcttt ggtaccaccc catctgagaa acaaggtatg gcttctctgt tccgttacat gcagcagaac tctgcagaca aggcaaactt caaccagggc ctgtgtgccc agaacaatca tgctccctca gacaccatcc ccgaaagccc caaactggag cagctggtag aatcccacat ccagcactcc ctcaatgcca tctgcacagg gccagcagcc caactgtgcc tgggcgagct tgctgtggtc cagaaatcca cacacctcat tggctctggc tcagaaaaga tgaacataca gatcctggaa gatacccata aggtgcagcc ccagccccct gccagctgca gctgctactt taaccaggcc ttccacctgc cctgccgcca catcctagcc atgctcagtg cccgccgcca ggtgctccag cccgacatgc tgccggctca gtggacggca ggctgtgcta ccagtctaga cagcatcctg ggcagcaagt ggagtgagac cctggataag cacctggcag tgactcacct caccgaggag gtgggtcagc tgttgcagca ctgcaccaag gaggagtttg agcggaggta tagcaccctg cgggaactgg ccgacagctg gattgggcct tatgagcagg tccaactctg a. It is sometimes possible for the material contained within the vial of "ZSWIM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
