Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GABPB2 cdna clone

GABPB2 cDNA Clone

Gene Names
GABPB2; GABPB-2
Synonyms
GABPB2; GABPB2 cDNA Clone; GABPB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctttggtggacttgggaaagaggttgctagaagcagcaagaaaaggccaagatgatgaagtgagaacgttgatggcaaatggcgccccattcaccacagactggcttggaacatcacccctccaccttgcagctcaatatggtcattattccacagcagaagtactccttcgagcaggtgttagcagggatgcccggactaaagtagacaggacccccttgcacatggctgcagccgatggacatgcgcacatcgtggaactgcttgttcggaatggtgcagatgtgaatgccaaggacatgctgaagatgacagctttgcattgggccacagagcgccaccatcgagatgtcgtagagttacttatcaaatatggagctgatgtccatgctttcagcaaatttgataaatcagcctttgacatagctctggagaaaaacaatgctgagattttggtcatcctccaggaagcaatgcagaatcaggtgaatgttaatccagagagagccaaccctgtgactgaccctgtgagtatggctgctccattcatcttcacgtcgggtgaggttgttaacctcgcaagccttatttcttcaaccaacaccaaaacaacctcaggtgacccccatgcctcaacagtacagttttcaaattctaccacctcagtgctggctacccttgcagctcttgctgaggcatcagtccccctctccaactcacacagagccacagccaatacagaggaaattatagaaggaaattccgttgactcatcaatccagcaagtaatggggagtggaggccagagggtcatcaccatagtgactgatggagtccctctgggtaatatccaaacttcaatccctactggaggcattggccagccatttattgtaactgtgcaagatggacagcaagttctaactgtacctgctggtaaggttgcagaggagactgtaattaaagaggaagaagaagagaagttgccactaacaaagaaaccaaggataggagagaagacaaacagtgtggaggaaagcaaggaaggcaatgaaagagagctactacagcaacaactccaggaggccaatcgaagagcccaggaataccgacaccagctcctaaagaaagagcaggaagcagaacagtaccgtcttaagctggaggccatagcccgacagcagcccaatggagttgatttcaccatggttgaagaggtggctgaggtagatgctgtagtagtcacagagggggagttggaagagagagagacaaaagtgactgggtcagcagggaccacagagcctcacactagagtttccatggcaactgtttcatcttaa
Sequence Length
1347
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,650 Da
NCBI Official Full Name
Homo sapiens GA binding protein transcription factor, beta subunit 2, mRNA
NCBI Official Synonym Full Names
GA binding protein transcription factor beta subunit 2
NCBI Official Symbol
GABPB2
NCBI Official Synonym Symbols
GABPB-2
NCBI Protein Information
GA-binding protein subunit beta-2
UniProt Protein Name
GA-binding protein subunit beta-2
Protein Family
UniProt Gene Name
GABPB2
UniProt Synonym Gene Names
GABP subunit beta-2; GABPB-2
UniProt Entry Name
GABP2_HUMAN

Uniprot Description

GABPB2: May function as transcription factor capable of interacting with purine rich repeats (GA repeats).

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 1q21.3

Cellular Component: nucleus

Molecular Function: protein binding; protein heterodimerization activity

Biological Process: positive regulation of transcription from RNA polymerase II promoter

Research Articles on GABPB2

Similar Products

Product Notes

The GABPB2 gabpb2 (Catalog #AAA1270098) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctttgg tggacttggg aaagaggttg ctagaagcag caagaaaagg ccaagatgat gaagtgagaa cgttgatggc aaatggcgcc ccattcacca cagactggct tggaacatca cccctccacc ttgcagctca atatggtcat tattccacag cagaagtact ccttcgagca ggtgttagca gggatgcccg gactaaagta gacaggaccc ccttgcacat ggctgcagcc gatggacatg cgcacatcgt ggaactgctt gttcggaatg gtgcagatgt gaatgccaag gacatgctga agatgacagc tttgcattgg gccacagagc gccaccatcg agatgtcgta gagttactta tcaaatatgg agctgatgtc catgctttca gcaaatttga taaatcagcc tttgacatag ctctggagaa aaacaatgct gagattttgg tcatcctcca ggaagcaatg cagaatcagg tgaatgttaa tccagagaga gccaaccctg tgactgaccc tgtgagtatg gctgctccat tcatcttcac gtcgggtgag gttgttaacc tcgcaagcct tatttcttca accaacacca aaacaacctc aggtgacccc catgcctcaa cagtacagtt ttcaaattct accacctcag tgctggctac ccttgcagct cttgctgagg catcagtccc cctctccaac tcacacagag ccacagccaa tacagaggaa attatagaag gaaattccgt tgactcatca atccagcaag taatggggag tggaggccag agggtcatca ccatagtgac tgatggagtc cctctgggta atatccaaac ttcaatccct actggaggca ttggccagcc atttattgta actgtgcaag atggacagca agttctaact gtacctgctg gtaaggttgc agaggagact gtaattaaag aggaagaaga agagaagttg ccactaacaa agaaaccaag gataggagag aagacaaaca gtgtggagga aagcaaggaa ggcaatgaaa gagagctact acagcaacaa ctccaggagg ccaatcgaag agcccaggaa taccgacacc agctcctaaa gaaagagcag gaagcagaac agtaccgtct taagctggag gccatagccc gacagcagcc caatggagtt gatttcacca tggttgaaga ggtggctgag gtagatgctg tagtagtcac agagggggag ttggaagaga gagagacaaa agtgactggg tcagcaggga ccacagagcc tcacactaga gtttccatgg caactgtttc atcttaa. It is sometimes possible for the material contained within the vial of "GABPB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.