GBP1 cdna clone
GBP1 cDNA Clone
Synonyms
GBP1; GBP1 cDNA Clone; GBP1 cdna clone
Sequence
atggcatcagagatccacatgacaggcccaatgtgcctcattgagaacactaatgggcgactgatggcgaatccagaagctctgaagatcctttctgccattacacagcctatggtggtggtggcaattgtgggcctctaccgcacaggcaaatcctacctgatgaacaagctggctggaaagaaaaagggcttctctctgggctccacggtgcagtctcacactaaaggaatctggatgtggtgtgtgccccaccccaagaagccaggccacatcctagttctgctggacaccgagggtctgggagatgtagagaagggtgacaaccagaatgactcctggatcttcgccctggccgtcctcctgagcagcaccttcgtgtacaatagcataggaaccatcaaccagcaggctatggaccaactgtactatgtgacagagctgacacatagaatccgatcaaaatcctcacctgatgagaatgagaatgaggttgaggattcagctgactttgtgagcttcttcccagactttgtgtggacactgagagatttctccctggacttggaagcagatggacaacccctcacaccagatgagtacctgacatactccctgaagctgaagaaaggtaccagtcaaaaagatgaaacttttaacctgcccagactctgtatccggaaattcttcccaaagaaaaaatgctttgtctttgatcggcccgttcaccgcaggaagcttgcccagctcgagaaactacaagatgaagagctggaccccgaatttgtgcaacaagtagcagacttctgttcctacatctttagtaattccaaaactaaaactctttcaggaggcatccaggtcaacgggcctcgtctagagagcctggtgctgacctacgtcaatgccatcagcagtggggatctgccgtgcatggagaacgcagtcctggccttggcccagatagagaactcagctgcagtgcaaaaggctattgcccactatgaacagcagatgggccagaaggtgcagctgcccacagaaagcctccaggagctgctggacctgcacagggacagtgagagagaggccattgaagtcttcatcaggagttccttcaaagatgtggaccatctatttcaaaaggagttagcggcccagctagaaaaaaagcgggatgacttttgtaaacagaatcaggaagcatcatcagatcgttgctcaggtttacttcaggtcattttcagtcctctagaagaagaagtgaaggcgggaatttattcgaaaccagggggctatcgtctctttgttcagaagctacaagacctgaagaaaaagtactatgaggaaccgaggaaggggatacaggctgaagagattctgcagacatacttgaaatccaaggagtctatgactgatgcaattctccagacagaccagactctcacagaaaaagaaaaggagattgaagtggaacgtgtgaaagctgagtctgcacaggcttcagcaaaaatgttgcaggaaatgcaaagaaagaatgagcagatgatggaacagaaggagaggagttatcaggaacacttgaaacaactgactgagaagatggagaacgacagggtccagttgctgaaagagcaagagaggaccctcgctcttaaacttcaggaacaggagcaactactaaaagagggatttcaaaaagaaagcagaataatgaaaaatgagatacaggatctccagacgaaaatgagacgacgaaaggcatgtaccataagctaa
Sequence Length
1779
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
67,931 Da
NCBI Official Full Name
Homo sapiens guanylate binding protein 1, interferon-inducible, 67kDa, mRNA
NCBI Official Synonym Full Names
guanylate binding protein 1
NCBI Official Symbol
GBP1
NCBI Protein Information
guanylate-binding protein 1
UniProt Protein Name
Guanylate-binding protein 1
Protein Family
UniProt Gene Name
GBP1
UniProt Synonym Gene Names
GBP-1; HuGBP-1
UniProt Entry Name
GBP1_HUMAN
NCBI Description
Guanylate binding protein expression is induced by interferon. Guanylate binding proteins are characterized by their ability to specifically bind guanine nucleotides (GMP, GDP, and GTP) and are distinguished from the GTP-binding proteins by the presence of 2 binding motifs rather than 3. [provided by RefSeq, Jul 2008]
Uniprot Description
GBP1: a member of the family of large GTP-binding proteins (GBPs) that is inducible by interferon. Possesses a high GTP hydrolysis activity. GBPs are the most abundant cellular proteins expressed in response to interferon-gamma (IFN-gamma). IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), and interleukin-1beta (IL-1beta) strongly induce the expression of GBP-1, -2, and -3.
Protein type: Cell adhesion; Vesicle; Hydrolase
Chromosomal Location of Human Ortholog: 1p22.2
Cellular Component: cytosol
Molecular Function: actin binding; cytokine binding; enzyme binding; Hsp90 protein binding; identical protein binding; protein binding; spectrin binding
Biological Process: negative regulation of T cell receptor signaling pathway; regulation of calcium-mediated signaling
Research Articles on GBP1
Similar Products
Product Notes
The GBP1 gbp1 (Catalog #AAA1269676) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatcag agatccacat gacaggccca atgtgcctca ttgagaacac taatgggcga ctgatggcga atccagaagc tctgaagatc ctttctgcca ttacacagcc tatggtggtg gtggcaattg tgggcctcta ccgcacaggc aaatcctacc tgatgaacaa gctggctgga aagaaaaagg gcttctctct gggctccacg gtgcagtctc acactaaagg aatctggatg tggtgtgtgc cccaccccaa gaagccaggc cacatcctag ttctgctgga caccgagggt ctgggagatg tagagaaggg tgacaaccag aatgactcct ggatcttcgc cctggccgtc ctcctgagca gcaccttcgt gtacaatagc ataggaacca tcaaccagca ggctatggac caactgtact atgtgacaga gctgacacat agaatccgat caaaatcctc acctgatgag aatgagaatg aggttgagga ttcagctgac tttgtgagct tcttcccaga ctttgtgtgg acactgagag atttctccct ggacttggaa gcagatggac aacccctcac accagatgag tacctgacat actccctgaa gctgaagaaa ggtaccagtc aaaaagatga aacttttaac ctgcccagac tctgtatccg gaaattcttc ccaaagaaaa aatgctttgt ctttgatcgg cccgttcacc gcaggaagct tgcccagctc gagaaactac aagatgaaga gctggacccc gaatttgtgc aacaagtagc agacttctgt tcctacatct ttagtaattc caaaactaaa actctttcag gaggcatcca ggtcaacggg cctcgtctag agagcctggt gctgacctac gtcaatgcca tcagcagtgg ggatctgccg tgcatggaga acgcagtcct ggccttggcc cagatagaga actcagctgc agtgcaaaag gctattgccc actatgaaca gcagatgggc cagaaggtgc agctgcccac agaaagcctc caggagctgc tggacctgca cagggacagt gagagagagg ccattgaagt cttcatcagg agttccttca aagatgtgga ccatctattt caaaaggagt tagcggccca gctagaaaaa aagcgggatg acttttgtaa acagaatcag gaagcatcat cagatcgttg ctcaggttta cttcaggtca ttttcagtcc tctagaagaa gaagtgaagg cgggaattta ttcgaaacca gggggctatc gtctctttgt tcagaagcta caagacctga agaaaaagta ctatgaggaa ccgaggaagg ggatacaggc tgaagagatt ctgcagacat acttgaaatc caaggagtct atgactgatg caattctcca gacagaccag actctcacag aaaaagaaaa ggagattgaa gtggaacgtg tgaaagctga gtctgcacag gcttcagcaa aaatgttgca ggaaatgcaa agaaagaatg agcagatgat ggaacagaag gagaggagtt atcaggaaca cttgaaacaa ctgactgaga agatggagaa cgacagggtc cagttgctga aagagcaaga gaggaccctc gctcttaaac ttcaggaaca ggagcaacta ctaaaagagg gatttcaaaa agaaagcaga ataatgaaaa atgagataca ggatctccag acgaaaatga gacgacgaaa ggcatgtacc ataagctaa. It is sometimes possible for the material contained within the vial of "GBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
