Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF141 cdna clone

RNF141 cDNA Clone

Gene Names
RNF141; ZFP26; ZNF230
Synonyms
RNF141; RNF141 cDNA Clone; RNF141 cdna clone
Ordering
For Research Use Only!
Sequence
atgggacagcaaatttcggatcagacacagttggttattaacaagttaccagaaaaagtagcaaaacatgttacgttggttcgagagagtggctccttaacttatgaagaatttctcgggagagtagctgagcttaatgatgtaacggctaaagtggcttctggccaggaaaaacatcttctctttgaggtacaacctgggtctgattcctctgctttttggaaagtggttgtacgggtggtctgtaccaagattaacaaaagcagtggcattgtggaggcatcacggatcatgaatttataccagtttattcaactttataaagatatcacaagtcaagcagcaggagtattggcacagagctccacctctgaagaacctgatgaaaactcatcctctgtaacatcttgtcaggctagtctttggatgggaagggtgaagcagctgaccgatgaggaggagtgttgtatctgtatggatgggcgggctgacctcatcctgccttgtgctcacagcttttgtcagaagtgtattgataaatggagtgatcgacacaggaattgccctatttgtcgcctacagatgactggagcaaatgaatcttgggtggtatcagatgcacccactgaagatgatatggctaactatattcttaacatggctgatgaggcaggccagccccacaggccatga
Sequence Length
693
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
– Da
NCBI Official Full Name
Homo sapiens ring finger protein 141, mRNA
NCBI Official Synonym Full Names
ring finger protein 141
NCBI Official Symbol
RNF141
NCBI Official Synonym Symbols
ZFP26; ZNF230
NCBI Protein Information
RING finger protein 141
UniProt Protein Name
RING finger protein 141
Protein Family
UniProt Gene Name
RNF141
UniProt Synonym Gene Names
ZNF230
UniProt Entry Name
RN141_HUMAN

NCBI Description

The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. Abundant expression of this gene was found in the testicular tissue of fertile men, but was not detected in azoospermic patients. Studies of the mouse counterpart suggest that this gene may function as a testis specific transcription factor during spermatogenesis. [provided by RefSeq, Jul 2008]

Uniprot Description

RNF141: May be involved in spermatogenesis. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 11p15.4

Molecular Function: ubiquitin-protein ligase activity

Biological Process: protein autoubiquitination

Research Articles on RNF141

Similar Products

Product Notes

The RNF141 rnf141 (Catalog #AAA1269462) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggacagc aaatttcgga tcagacacag ttggttatta acaagttacc agaaaaagta gcaaaacatg ttacgttggt tcgagagagt ggctccttaa cttatgaaga atttctcggg agagtagctg agcttaatga tgtaacggct aaagtggctt ctggccagga aaaacatctt ctctttgagg tacaacctgg gtctgattcc tctgcttttt ggaaagtggt tgtacgggtg gtctgtacca agattaacaa aagcagtggc attgtggagg catcacggat catgaattta taccagttta ttcaacttta taaagatatc acaagtcaag cagcaggagt attggcacag agctccacct ctgaagaacc tgatgaaaac tcatcctctg taacatcttg tcaggctagt ctttggatgg gaagggtgaa gcagctgacc gatgaggagg agtgttgtat ctgtatggat gggcgggctg acctcatcct gccttgtgct cacagctttt gtcagaagtg tattgataaa tggagtgatc gacacaggaa ttgccctatt tgtcgcctac agatgactgg agcaaatgaa tcttgggtgg tatcagatgc acccactgaa gatgatatgg ctaactatat tcttaacatg gctgatgagg caggccagcc ccacaggcca tga. It is sometimes possible for the material contained within the vial of "RNF141, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.