Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ENG cdna clone

ENG cDNA Clone

Gene Names
ENG; END; HHT1; ORW1
Synonyms
ENG; ENG cDNA Clone; ENG cdna clone
Ordering
For Research Use Only!
Sequence
atggaccgcggcacgctccctctggctgttgccctgctgctggccagctgcagcctcagccccacaagtcttgcagaaacagtccattgtgaccttcagcctgtgggccccgagagggacgaggtgacatataccactagccaggtctcgaagggctgcgtggctcaggcccccaatgccatccttgaagtccatgtcctcttcctggagttcccaacgggcccgtcacagctggagctgactctccaggcatccaagcaaaatggcacctggccccgagaggtgcttctggtcctcagtgtaaacagcagtgtcttcctgcatctccaggccctgggaatcccactgcacttggcctacaattccagcctggtcaccttccaagagcccccgggggtcaacaccacagagctgccatccttccccaagacccagatccttgagtgggcagctgagaggggccccatcacctctgctgctgagctgaatgacccccagagcatcctcctccgactgggccaagcccaggggtcactgtccttctgcatgctggaagccagccaggacatgggccgcacgctcgagtggcggccgcgtactccagccttggtccggggctgccacttggaaggcgtggccggccacaaggaggcgcacatcctgagggtcctgccgggccactcggccgggccccggacggtgacggtgaaggtggaactgagctgcgcacccggggatctcgatgccgtcctcatcctgcagggtcccccctacgtgtcctggctcatcgacgccaaccacaacatgcagatctggaccactggagaatactccttcaagatctttccagagaaaaacattcgtggcttcaagctcccagacacacctcaaggcctcctgggggaggcccggatgctcaatgccagcattgtggcatccttcgtggagctaccgctggccagcattgtctcacttcatgcctccagctgcggtggtaggctgcagacctcacccgcaccgatccagaccactcctcccaaggacacttgtagcccggagctgctcatgtccttgatccagacaaagtgtgccgacgacgccatgaccctggtactaaagaaagagcttgttgcgcatttgaagtgcaccatcacgggcctgaccttctgggaccccagctgtgaggcagaggacaggggtgacaagtttgtcttgcgcagtgcttactccagctgtggcatgcaggtgtcagcaagtatgatcagcaatgaggcggtggtcaatatcctgtcgagctcatcaccacagcggaaaaaggtgcactgcctcaacatggacagcctctctttccagctgggcctctacctcagcccacacttcctccaggcctccaacaccatcgagccggggcagcagagctttgtgcaggtcagagtgtccccatccgtctccgagttcctgctccagttagacagctgccacctggacttggggcctgagggaggcaccgtggaactcatccagggccgggcggccaagggcaactgtgtgagcctgctgtccccaagccccgagggtgacccgcgcttcagcttcctcctccacttctacacagtacccatacccaaaaccggcaccctcagctgcacggtagccctgcgtcccaagaccgggtctcaagaccaggaagtccataggactgtcttcatgcgcttgaacatcatcagccctgacctgtctggttgcacaagcaaaggcctcgtcctgcccgccgtgctgggcatcacctttggtgccttcctcatcggggccctgctcactgctgcactctggtacatctactcgcacacgcgttcccccagcaagcgggagcccgtggtggcggtggctgccccggcctcctcggagagcagcagcaccaaccacagcatcgggagcacccagagcaccccctgctccaccagcagcatggcatag
Sequence Length
1977
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,542 Da
NCBI Official Full Name
Homo sapiens endoglin, mRNA
NCBI Official Synonym Full Names
endoglin
NCBI Official Symbol
ENG
NCBI Official Synonym Symbols
END; HHT1; ORW1
NCBI Protein Information
endoglin
UniProt Protein Name
Endoglin
Protein Family
UniProt Gene Name
ENG
UniProt Synonym Gene Names
END
UniProt Entry Name
EGLN_HUMAN

NCBI Description

This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]

Uniprot Description

ENG: Major glycoprotein of vascular endothelium. May play a critical role in the binding of endothelial cells to integrins and/or other RGD receptors. Homodimer that forms an heteromeric complex with the signaling receptors for transforming growth factor-beta: TGFBR1 and/or TGFBR2. It is able to bind TGF-beta 1, and 3 efficiently and TGF-beta 2 less efficiently. Interacts with TCTEX1D4. Interacts with ARRB2. Endoglin is restricted to endothelial cells in all tissues except bone marrow. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Receptor, misc.; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 9q34.11

Cellular Component: cytoplasm; external side of plasma membrane; extracellular space; focal adhesion; nucleoplasm; receptor complex

Molecular Function: activin binding; galactose binding; glycosaminoglycan binding; protein binding; punt binding; transforming growth factor beta binding; transforming growth factor beta receptor, cytoplasmic mediator activity

Biological Process: artery morphogenesis; BMP signaling pathway; central nervous system vasculogenesis; heart looping; negative regulation of cell migration; negative regulation of protein amino acid autophosphorylation; patterning of blood vessels; positive regulation of BMP signaling pathway; positive regulation of protein amino acid phosphorylation; positive regulation of transcription from RNA polymerase II promoter; regulation of transcription, DNA-dependent; regulation of transforming growth factor beta receptor signaling pathway; smooth muscle development; sprouting angiogenesis; vasculogenesis; venous blood vessel morphogenesis

Disease: Telangiectasia, Hereditary Hemorrhagic, Of Rendu, Osler, And Weber

Research Articles on ENG

Similar Products

Product Notes

The ENG eng (Catalog #AAA1269451) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaccgcg gcacgctccc tctggctgtt gccctgctgc tggccagctg cagcctcagc cccacaagtc ttgcagaaac agtccattgt gaccttcagc ctgtgggccc cgagagggac gaggtgacat ataccactag ccaggtctcg aagggctgcg tggctcaggc ccccaatgcc atccttgaag tccatgtcct cttcctggag ttcccaacgg gcccgtcaca gctggagctg actctccagg catccaagca aaatggcacc tggccccgag aggtgcttct ggtcctcagt gtaaacagca gtgtcttcct gcatctccag gccctgggaa tcccactgca cttggcctac aattccagcc tggtcacctt ccaagagccc ccgggggtca acaccacaga gctgccatcc ttccccaaga cccagatcct tgagtgggca gctgagaggg gccccatcac ctctgctgct gagctgaatg acccccagag catcctcctc cgactgggcc aagcccaggg gtcactgtcc ttctgcatgc tggaagccag ccaggacatg ggccgcacgc tcgagtggcg gccgcgtact ccagccttgg tccggggctg ccacttggaa ggcgtggccg gccacaagga ggcgcacatc ctgagggtcc tgccgggcca ctcggccggg ccccggacgg tgacggtgaa ggtggaactg agctgcgcac ccggggatct cgatgccgtc ctcatcctgc agggtccccc ctacgtgtcc tggctcatcg acgccaacca caacatgcag atctggacca ctggagaata ctccttcaag atctttccag agaaaaacat tcgtggcttc aagctcccag acacacctca aggcctcctg ggggaggccc ggatgctcaa tgccagcatt gtggcatcct tcgtggagct accgctggcc agcattgtct cacttcatgc ctccagctgc ggtggtaggc tgcagacctc acccgcaccg atccagacca ctcctcccaa ggacacttgt agcccggagc tgctcatgtc cttgatccag acaaagtgtg ccgacgacgc catgaccctg gtactaaaga aagagcttgt tgcgcatttg aagtgcacca tcacgggcct gaccttctgg gaccccagct gtgaggcaga ggacaggggt gacaagtttg tcttgcgcag tgcttactcc agctgtggca tgcaggtgtc agcaagtatg atcagcaatg aggcggtggt caatatcctg tcgagctcat caccacagcg gaaaaaggtg cactgcctca acatggacag cctctctttc cagctgggcc tctacctcag cccacacttc ctccaggcct ccaacaccat cgagccgggg cagcagagct ttgtgcaggt cagagtgtcc ccatccgtct ccgagttcct gctccagtta gacagctgcc acctggactt ggggcctgag ggaggcaccg tggaactcat ccagggccgg gcggccaagg gcaactgtgt gagcctgctg tccccaagcc ccgagggtga cccgcgcttc agcttcctcc tccacttcta cacagtaccc atacccaaaa ccggcaccct cagctgcacg gtagccctgc gtcccaagac cgggtctcaa gaccaggaag tccataggac tgtcttcatg cgcttgaaca tcatcagccc tgacctgtct ggttgcacaa gcaaaggcct cgtcctgccc gccgtgctgg gcatcacctt tggtgccttc ctcatcgggg ccctgctcac tgctgcactc tggtacatct actcgcacac gcgttccccc agcaagcggg agcccgtggt ggcggtggct gccccggcct cctcggagag cagcagcacc aaccacagca tcgggagcac ccagagcacc ccctgctcca ccagcagcat ggcatag. It is sometimes possible for the material contained within the vial of "ENG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.