Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C3orf26 cdna clone

C3orf26 cDNA Clone

Gene Names
CMSS1; C3orf26
Synonyms
C3orf26; C3orf26 cDNA Clone; C3orf26 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagacgatctcggagacgagtggtgggagaaccagccgactggagcaggcagcagcccagaagcatcagatggtgaaggagaaggagacacagaagtgatgcagcaggagacagttccagttcctgtaccttcagagaaaaccaaacagcctaaagaatgttttttgatacaaccaaaggaaagaaaagagaataccaccaagaccaggaaaagaagaaagaagaaaattactgatgttcttgcaaaatcagaaccaaaaccagggttacctgaagacctacagaagctgatgaaggactattatagcagcagacgcttggtgattgaattagaagaactgaacctgccagactcctgtttcctcaaggccaatgatttgactcacagtctttcctcatacctaaaaggaatttgtcctaagtgggtaaaacttaggaagaaccacagtgagaagaaatcggtcctgatgctgatcatctgcagctcggccgtccgagccctggagctcattaggtcgatgacagcattcagaggagacggcaaagttataaaattatttgcaaagcacataaaggtccaggcgcaggtaaagttgctggagaagcgtgtggtgcacctgggtgtaggaactccggggagaattaaagaacttgttaaacaaggtggccttaatttgagccccttaaaatttctggtttttgactggaactggagagatcagaagttgaggagaatgatggacattcccgagataagaaaggaggtattcgaacttctggaaatgggagtgctcagtctgtgcaagtcagaatccttgaaactgggccttttctaa
Sequence Length
840
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,964 Da
NCBI Official Full Name
Homo sapiens chromosome 3 open reading frame 26, mRNA
NCBI Official Synonym Full Names
cms1 ribosomal small subunit homolog (yeast)
NCBI Official Symbol
CMSS1
NCBI Official Synonym Symbols
C3orf26
NCBI Protein Information
protein CMSS1
UniProt Protein Name
Protein CMSS1
UniProt Gene Name
CMSS1
UniProt Synonym Gene Names
C3orf26
UniProt Entry Name
CMS1_HUMAN

Uniprot Description

CMSS1: Belongs to the CMS1 family.

Chromosomal Location of Human Ortholog: 3q12.1

Research Articles on C3orf26

Similar Products

Product Notes

The C3orf26 cmss1 (Catalog #AAA1269331) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagacg atctcggaga cgagtggtgg gagaaccagc cgactggagc aggcagcagc ccagaagcat cagatggtga aggagaagga gacacagaag tgatgcagca ggagacagtt ccagttcctg taccttcaga gaaaaccaaa cagcctaaag aatgtttttt gatacaacca aaggaaagaa aagagaatac caccaagacc aggaaaagaa gaaagaagaa aattactgat gttcttgcaa aatcagaacc aaaaccaggg ttacctgaag acctacagaa gctgatgaag gactattata gcagcagacg cttggtgatt gaattagaag aactgaacct gccagactcc tgtttcctca aggccaatga tttgactcac agtctttcct catacctaaa aggaatttgt cctaagtggg taaaacttag gaagaaccac agtgagaaga aatcggtcct gatgctgatc atctgcagct cggccgtccg agccctggag ctcattaggt cgatgacagc attcagagga gacggcaaag ttataaaatt atttgcaaag cacataaagg tccaggcgca ggtaaagttg ctggagaagc gtgtggtgca cctgggtgta ggaactccgg ggagaattaa agaacttgtt aaacaaggtg gccttaattt gagcccctta aaatttctgg tttttgactg gaactggaga gatcagaagt tgaggagaat gatggacatt cccgagataa gaaaggaggt attcgaactt ctggaaatgg gagtgctcag tctgtgcaag tcagaatcct tgaaactggg ccttttctaa. It is sometimes possible for the material contained within the vial of "C3orf26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.