EEF1G cdna clone
EEF1G cDNA Clone
Gene Names
EEF1G; EF1G; GIG35
Synonyms
EEF1G; EEF1G cDNA Clone; EEF1G cdna clone
Sequence
atggcggctgggaccctgtacacgtatcctgaaaactggagggccttcaaggctctcatcgctgctcagtacagcggggctcaggtccgcgtgctctccgcaccaccccacttccattttggccaaaccaaccgcacccctgaatttctccgcaaatttcctgccggcaaggtcccagcatttgagggtgatgatggattctgtgtgtttgagagcaacgccattgcctactatgtgagcaatgaggagctgcggggaagtactccagaggcagcagcccaggtggtgcagtgggtgagctttgctgattccgatatagtgcccccagccagtacctgggtgttccccaccttgggcatcatgcaccacaacaaacaggccactgagaatgcaaaggaggaagtgaggcgaattctggggctgctggatgcttacttgaagacgaggacttttctggtgggcgaacgagtgacattggctgacatcacagttgtctgcaccctgttgtggctctataagcaggttctagagccttctttccgccaggcctttcccaataccaaccgctggttcctcacctgcattaaccagccccagttccgggctgtcttgggcgaagtgaaactgtgtgagaagatggcccagtttgatgctaaaaagtttgcagagacccaacctaaaaaggacacaccacggaaagagaagggttcacgggaagagaagcagaagccccaggctgagcggaaggaggagaaaaaggcggctgcccctgctcctgaggaggagatggatgaatgtgagcaggcgctggctgctgagcccaaggccaaggaccccttcgctcacctgcccaagagtacctttgtgttggatgaatttaagcgcaagtactccaatgaggacacactctctgtggcactgccatatttctgggagcactttgataaggacggctggtccctgtggtactcagagtatcgcttccctgaagaactcactcagaccttcatgagctgcaatctcatcactggaatgttccagcgactggacaagctgaggaagaatgccttcgccagtgtcatcctttttggaaccaacaatagcagctccatttctggagtctgggtcttccgaggccaggagcttgcctttccgctgagtccagattggcaggtggactacgagtcatacacatggcggaaactggatcctggcagcgaggagacccagacgctggttcgagagtacttttcctgggagggggccttccagcatgtgggcaaagccttcaatcagggcaagatcttcaagtga
Sequence Length
1314
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
56,150 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation elongation factor 1 gamma, mRNA
NCBI Official Synonym Full Names
eukaryotic translation elongation factor 1 gamma
NCBI Official Symbol
EEF1G
NCBI Official Synonym Symbols
EF1G; GIG35
NCBI Protein Information
elongation factor 1-gamma
UniProt Protein Name
Elongation factor 1-gamma
Protein Family
UniProt Gene Name
EEF1G
UniProt Synonym Gene Names
EF1G; EF-1-gamma
UniProt Entry Name
EF1G_HUMAN
NCBI Description
This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit contains an N-terminal glutathione transferase domain, which may be involved in regulating the assembly of multisubunit complexes containing this elongation factor and aminoacyl-tRNA synthetases. [provided by RefSeq, Jul 2008]
Uniprot Description
EEF1G: Probably plays a role in anchoring the complex to other cellular components.
Protein type: Translation elongation; Translation
Chromosomal Location of Human Ortholog: 11q12.3
Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; endoplasmic reticulum; membrane; nucleus
Molecular Function: glutathione transferase activity; protein binding; translation elongation factor activity
Biological Process: glutathione metabolic process; response to virus; translational elongation
Research Articles on EEF1G
Similar Products
Product Notes
The EEF1G eef1g (Catalog #AAA1269046) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg ggaccctgta cacgtatcct gaaaactgga gggccttcaa ggctctcatc gctgctcagt acagcggggc tcaggtccgc gtgctctccg caccacccca cttccatttt ggccaaacca accgcacccc tgaatttctc cgcaaatttc ctgccggcaa ggtcccagca tttgagggtg atgatggatt ctgtgtgttt gagagcaacg ccattgccta ctatgtgagc aatgaggagc tgcggggaag tactccagag gcagcagccc aggtggtgca gtgggtgagc tttgctgatt ccgatatagt gcccccagcc agtacctggg tgttccccac cttgggcatc atgcaccaca acaaacaggc cactgagaat gcaaaggagg aagtgaggcg aattctgggg ctgctggatg cttacttgaa gacgaggact tttctggtgg gcgaacgagt gacattggct gacatcacag ttgtctgcac cctgttgtgg ctctataagc aggttctaga gccttctttc cgccaggcct ttcccaatac caaccgctgg ttcctcacct gcattaacca gccccagttc cgggctgtct tgggcgaagt gaaactgtgt gagaagatgg cccagtttga tgctaaaaag tttgcagaga cccaacctaa aaaggacaca ccacggaaag agaagggttc acgggaagag aagcagaagc cccaggctga gcggaaggag gagaaaaagg cggctgcccc tgctcctgag gaggagatgg atgaatgtga gcaggcgctg gctgctgagc ccaaggccaa ggaccccttc gctcacctgc ccaagagtac ctttgtgttg gatgaattta agcgcaagta ctccaatgag gacacactct ctgtggcact gccatatttc tgggagcact ttgataagga cggctggtcc ctgtggtact cagagtatcg cttccctgaa gaactcactc agaccttcat gagctgcaat ctcatcactg gaatgttcca gcgactggac aagctgagga agaatgcctt cgccagtgtc atcctttttg gaaccaacaa tagcagctcc atttctggag tctgggtctt ccgaggccag gagcttgcct ttccgctgag tccagattgg caggtggact acgagtcata cacatggcgg aaactggatc ctggcagcga ggagacccag acgctggttc gagagtactt ttcctgggag ggggccttcc agcatgtggg caaagccttc aatcagggca agatcttcaa gtga. It is sometimes possible for the material contained within the vial of "EEF1G, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
