Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLC4 cdna clone

KLC4 cDNA Clone

Gene Names
KLC4; KNSL8; bA387M24.3
Synonyms
KLC4; KLC4 cDNA Clone; KLC4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaggcctggtgttggggcagcgggatgagcctgcaggccaccggctcagccaagaggagatcctggggagcacacggctggtcagccaagggctagaggccctacgcagtgaacaccaggccgtgctgcaaagcctgtcccagaccattgagtgtctgcagcagggaggccatgaggaagggctggtgcatgagaaggcccggcagcttcgccgttctatggaaaacattgagctcgggctgagtgaggcccaggtgatgctggctctagccagccacctgagcacagtggagtcggagaaacagaagctgcgggctcaggtgcggcggctatgccaggagaaccagtggctgcgggatgagctggctggcacccagcagcggctacagcgcagtgaacaggctgtggctcagctggaggaggaaaagaagcacctggagttcctggggcagctgcggcagtatgatgaggatggacatacctcggaggagaaagaaggcgatgccaccaaggattccctggatgacctctttcctaatgaggaggaagaggaccccagcaatggcttgtcccgtggtcaaggtgctacagcagctcagcagggtggatatgagatcccagcaaggttgcggacgttgcacaacctggtgatccagtacgcagcccaaggtcgctatgaggtggccgtgccactctgtaagcaggcactagaggacctggagcgcacatcaggccgtggccaccctgatgtcgccaccatgctcaacatccttgctttggtgtatcgtgaccagaataagtataaggaagctgcccacctgctgaatgatgcccttagcatccgggagagcaccttgggacctgaccatcctgctgtcagtattccttgccctccccaccccacgccccgcaccccccaccattgctgttttggcctctcttag
Sequence Length
948
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,640 Da
NCBI Official Full Name
Homo sapiens kinesin light chain 4, mRNA
NCBI Official Synonym Full Names
kinesin light chain 4
NCBI Official Symbol
KLC4
NCBI Official Synonym Symbols
KNSL8; bA387M24.3
NCBI Protein Information
kinesin light chain 4
UniProt Protein Name
Kinesin light chain 4
Protein Family
UniProt Gene Name
KLC4
UniProt Synonym Gene Names
KNSL8; KLC 4
UniProt Entry Name
KLC4_HUMAN

Uniprot Description

KLC4: Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. The light chain may function in coupling of cargo to the heavy chain or in the modulation of its ATPase activity. Belongs to the kinesin light chain family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Microtubule-binding; Motor

Chromosomal Location of Human Ortholog: 6p21.1

Molecular Function: protein binding

Research Articles on KLC4

Similar Products

Product Notes

The KLC4 klc4 (Catalog #AAA1268940) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaggcc tggtgttggg gcagcgggat gagcctgcag gccaccggct cagccaagag gagatcctgg ggagcacacg gctggtcagc caagggctag aggccctacg cagtgaacac caggccgtgc tgcaaagcct gtcccagacc attgagtgtc tgcagcaggg aggccatgag gaagggctgg tgcatgagaa ggcccggcag cttcgccgtt ctatggaaaa cattgagctc gggctgagtg aggcccaggt gatgctggct ctagccagcc acctgagcac agtggagtcg gagaaacaga agctgcgggc tcaggtgcgg cggctatgcc aggagaacca gtggctgcgg gatgagctgg ctggcaccca gcagcggcta cagcgcagtg aacaggctgt ggctcagctg gaggaggaaa agaagcacct ggagttcctg gggcagctgc ggcagtatga tgaggatgga catacctcgg aggagaaaga aggcgatgcc accaaggatt ccctggatga cctctttcct aatgaggagg aagaggaccc cagcaatggc ttgtcccgtg gtcaaggtgc tacagcagct cagcagggtg gatatgagat cccagcaagg ttgcggacgt tgcacaacct ggtgatccag tacgcagccc aaggtcgcta tgaggtggcc gtgccactct gtaagcaggc actagaggac ctggagcgca catcaggccg tggccaccct gatgtcgcca ccatgctcaa catccttgct ttggtgtatc gtgaccagaa taagtataag gaagctgccc acctgctgaa tgatgccctt agcatccggg agagcacctt gggacctgac catcctgctg tcagtattcc ttgccctccc caccccacgc cccgcacccc ccaccattgc tgttttggcc tctcttag. It is sometimes possible for the material contained within the vial of "KLC4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.