Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF238 cdna clone

ZNF238 cDNA Clone

Gene Names
ZBTB18; RP58; MRD22; TAZ-1; ZNF238; C2H2-171
Synonyms
ZNF238; ZNF238 cDNA Clone; ZNF238 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtttccagaccatagtagacatttgctacagtgtctgagcgagcagagacaccagggttttctttgtgactgcactgttctggtgggagatgcccagttccgagcgcaccgagctgtactggcttcatgcagcatgtatttccacatcttttacaaggaccagctggacaaaagagacattgttcatctgaacagcgacattgttacagcccccgctttcgctctcctgcttgaattcatgtatgaagggaaactccagttcaaagacttgcccattgaagacgtgctagcagctgccagttatctccacatgtatgacattgtcaaagtctgcaaaaagaagctgaaagagaaagccaccacggaggcagacagcaccaaaaaggaagaagatgcttcaagttgttcggacaaagtcgagagtctctccgatggcagcagccacatagcaggcgatttgcccagtgatgaagatgaaggagaagatgaaaaattgaacatcctgcccagcaaaagggacttggcggccgagcctgggaacatgtggatgcgattgccctcagactcagcaggcatcccccaggctggcggagaggcagagccacacgccacagcagctggaaaaacagtagccagcccctgcagctcaacagagtctttgtcccagaggtctgtcacctccgtgagggattcggcagatgttgactgtgtgctggacctgtctgtcaagtccagcctttcaggagttgaaaatctgaacagctcttatttctcttcacaggacgtgctgagaagcaacctggtgcaggtgaaggtggagaaagaggcttcctgtgatgagagtgatgttggcactaatgactatgacatggaacatagcactgtgaaagaaagtgtgagcactaataacagggtacagtatgagccggcccatctggctcccctgagggaggactcggtcttgagggagctggaccgggaggacaaagccagtgatgatgagatgatgaccccagagagcgagcgtgtccaggtggagggaggcatggagagcagtctgctcccctacgtctccaacatcctgagccccgcgggccagatcttcatgtgccccctgtgcaacaaggtcttccccagcccccacatcctgcagatccacctgagcacgcacttccgcgagcaggacggcatccgcagcaagcccgccgccgatgtcaacgtgcccacgtgctcgctgtgtgggaagactttctcttgcatgtacaccctcaagcgccacgagaggactcactcgggggagaagccctacacatgcacccagtgcggcaagagcttccagtactcgcacaacctgagccgccatgccgtggtgcacacccgcgagaagccgcacgcctgcaagtggtgcgagcgcaggttcacgcagtccggggacctgtacagacacattcgcaagttccactgtgagttggtgaactccttgtcggtcaaaagcgaagcactgagcttgcctactgtcagagactggaccttagaagatagctctcaagaactttggaaataa
Sequence Length
1569
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,366 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 238, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 18
NCBI Official Symbol
ZBTB18
NCBI Official Synonym Symbols
RP58; MRD22; TAZ-1; ZNF238; C2H2-171
NCBI Protein Information
zinc finger and BTB domain-containing protein 18
UniProt Protein Name
Zinc finger and BTB domain-containing protein 18
UniProt Gene Name
ZBTB18
UniProt Synonym Gene Names
RP58; TAZ1; ZNF238; TAZ-1
UniProt Entry Name
ZBT18_HUMAN

NCBI Description

This gene encodes a C2H2-type zinc finger protein which acts a transcriptional repressor of genes involved in neuronal development. The encoded protein recognizes a specific sequence motif and recruits components of chromatin to target genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]

Uniprot Description

ZNF238: Transcriptional repressor that plays a role in various developmental processes such as myogenesis and brain development. Plays a key role in myogenesis by directly repressing the expression of ID2 and ID3, 2 inhibitors of skeletal myogenesis. Also involved in controlling cell division of progenitor cells and regulating the survival of postmitotic cortical neurons. Specifically binds the consensus DNA sequence 5'- [AC]ACATCTG[GT][AC]-3' which contains the E box core, and acts by recruiting chromatin remodeling multiprotein complexes. May also play a role in the organization of chromosomes in the nucleus. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; Transcription factor

Chromosomal Location of Human Ortholog: 1q44

Cellular Component: intercellular bridge; microtubule cytoskeleton; nuclear chromosome; nucleoplasm; nucleus

Molecular Function: DNA binding; protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; skeletal muscle development

Disease: Mental Retardation, Autosomal Dominant 22

Research Articles on ZNF238

Similar Products

Product Notes

The ZNF238 zbtb18 (Catalog #AAA1268866) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtttc cagaccatag tagacatttg ctacagtgtc tgagcgagca gagacaccag ggttttcttt gtgactgcac tgttctggtg ggagatgccc agttccgagc gcaccgagct gtactggctt catgcagcat gtatttccac atcttttaca aggaccagct ggacaaaaga gacattgttc atctgaacag cgacattgtt acagcccccg ctttcgctct cctgcttgaa ttcatgtatg aagggaaact ccagttcaaa gacttgccca ttgaagacgt gctagcagct gccagttatc tccacatgta tgacattgtc aaagtctgca aaaagaagct gaaagagaaa gccaccacgg aggcagacag caccaaaaag gaagaagatg cttcaagttg ttcggacaaa gtcgagagtc tctccgatgg cagcagccac atagcaggcg atttgcccag tgatgaagat gaaggagaag atgaaaaatt gaacatcctg cccagcaaaa gggacttggc ggccgagcct gggaacatgt ggatgcgatt gccctcagac tcagcaggca tcccccaggc tggcggagag gcagagccac acgccacagc agctggaaaa acagtagcca gcccctgcag ctcaacagag tctttgtccc agaggtctgt cacctccgtg agggattcgg cagatgttga ctgtgtgctg gacctgtctg tcaagtccag cctttcagga gttgaaaatc tgaacagctc ttatttctct tcacaggacg tgctgagaag caacctggtg caggtgaagg tggagaaaga ggcttcctgt gatgagagtg atgttggcac taatgactat gacatggaac atagcactgt gaaagaaagt gtgagcacta ataacagggt acagtatgag ccggcccatc tggctcccct gagggaggac tcggtcttga gggagctgga ccgggaggac aaagccagtg atgatgagat gatgacccca gagagcgagc gtgtccaggt ggagggaggc atggagagca gtctgctccc ctacgtctcc aacatcctga gccccgcggg ccagatcttc atgtgccccc tgtgcaacaa ggtcttcccc agcccccaca tcctgcagat ccacctgagc acgcacttcc gcgagcagga cggcatccgc agcaagcccg ccgccgatgt caacgtgccc acgtgctcgc tgtgtgggaa gactttctct tgcatgtaca ccctcaagcg ccacgagagg actcactcgg gggagaagcc ctacacatgc acccagtgcg gcaagagctt ccagtactcg cacaacctga gccgccatgc cgtggtgcac acccgcgaga agccgcacgc ctgcaagtgg tgcgagcgca ggttcacgca gtccggggac ctgtacagac acattcgcaa gttccactgt gagttggtga actccttgtc ggtcaaaagc gaagcactga gcttgcctac tgtcagagac tggaccttag aagatagctc tcaagaactt tggaaataa. It is sometimes possible for the material contained within the vial of "ZNF238, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.