Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATP1B1 cdna clone

ATP1B1 cDNA Clone

Gene Names
ATP1B1; ATP1B
Synonyms
ATP1B1; ATP1B1 cDNA Clone; ATP1B1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccgcgggaaagccaaggaggagggcagctggaagaaattcatctggaactcagagaagaaggagtttctgggcaggaccggtggcagttggtttaagatccttctattctacgtaatattttatggctgcctggctggcatcttcatcggaaccatccaagtgatgctgctcaccatcagtgaatttaagcccacatatcaggaccgagtggccccgccaggattaacacagattcctcagatccagaagactgaaatttcctttcgtcctaatgatcccaagagctatgaggcatatgtactgaacatagttaggttcctggaaaagtacaaagattcagcccagagggatgacatgatttttgaagattgtggcgatgtgcccagtgaaccgaaagaacgaggagactttaatcatgaacgaggagagcgaaaggtctgcagattcaagcttgaatggctgggaaattgctctggattaaatgatgaaacttatggctacaaagagggcaaaccgtgcattattataaagctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaagttggaaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactgaaattcgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctga
Sequence Length
912
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
481
Molecular Weight
34,893 Da
NCBI Official Full Name
Homo sapiens ATPase, Na+/K+ transporting, beta 1 polypeptide, mRNA
NCBI Official Synonym Full Names
ATPase Na+/K+ transporting subunit beta 1
NCBI Official Symbol
ATP1B1
NCBI Official Synonym Symbols
ATP1B
NCBI Protein Information
sodium/potassium-transporting ATPase subunit beta-1
UniProt Protein Name
Sodium/potassium-transporting ATPase subunit beta-1
UniProt Gene Name
ATP1B1
UniProt Synonym Gene Names
ATP1B
UniProt Entry Name
AT1B1_HUMAN

NCBI Description

The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 1 subunit. Alternatively spliced transcript variants encoding different isoforms have been described, but their biological validity is not known. [provided by RefSeq, Mar 2010]

Uniprot Description

ATP1B1: This is the non-catalytic component of the active enzyme, which catalyzes the hydrolysis of ATP coupled with the exchange of Na(+) and K(+) ions across the plasma membrane. The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. Belongs to the X(+)/potassium ATPases subunit beta family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q24

Cellular Component: membrane; plasma membrane; sarcolemma; sodium:potassium-exchanging ATPase complex

Molecular Function: ATP binding; ATPase activator activity; ATPase activity; ATPase binding; drug binding; potassium ion binding; protein binding; sodium ion binding; sodium:potassium-exchanging ATPase activity

Biological Process: ATP metabolic process; cardiac muscle contraction; cellular calcium ion homeostasis; cellular potassium ion homeostasis; cellular sodium ion homeostasis; leukocyte migration; positive regulation of ATPase activity; positive regulation of defense response to virus by host; potassium ion import; protein stabilization; regulation of gene expression

Disease: Hypertension, Essential

Research Articles on ATP1B1

Similar Products

Product Notes

The ATP1B1 atp1b1 (Catalog #AAA1268843) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccgcg ggaaagccaa ggaggagggc agctggaaga aattcatctg gaactcagag aagaaggagt ttctgggcag gaccggtggc agttggttta agatccttct attctacgta atattttatg gctgcctggc tggcatcttc atcggaacca tccaagtgat gctgctcacc atcagtgaat ttaagcccac atatcaggac cgagtggccc cgccaggatt aacacagatt cctcagatcc agaagactga aatttccttt cgtcctaatg atcccaagag ctatgaggca tatgtactga acatagttag gttcctggaa aagtacaaag attcagccca gagggatgac atgatttttg aagattgtgg cgatgtgccc agtgaaccga aagaacgagg agactttaat catgaacgag gagagcgaaa ggtctgcaga ttcaagcttg aatggctggg aaattgctct ggattaaatg atgaaactta tggctacaaa gagggcaaac cgtgcattat tataaagctc aaccgagttc taggcttcaa acctaagcct cccaagaatg agtccttgga gacttaccca gtgatgaagt ataacccaaa tgtccttccc gttcagtgca ctggcaagcg agatgaagat aaggataaag ttggaaatgt ggagtatttt ggactgggca actcccctgg ttttcctctg cagtattatc cgtactatgg caaactcctg cagcccaaat acctgcagcc cctgctggcc gtacagttca ccaatcttac catggacact gaaattcgca tagagtgtaa ggcgtacggt gagaacattg ggtacagtga gaaagaccgt tttcagggac gttttgatgt aaaaattgaa gttaagagct ga. It is sometimes possible for the material contained within the vial of "ATP1B1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.